... Notice a few things about this code Instead of the classic C+ + static_cast (or dynamic_cast), we use a casting construct that is introduced in C+ +/CLI, safe_cast A safe cast is a cast in which there ... want to call the appropriate decay method, either beta decay or alpha decay These decay methods of the RadioactiveAtom class will update the atomic number and isotope number of the atom according ... Interface Classes Interfaces are not something that is available in classic C+ +, although something like an interface could be created by using an abstract base class in which all the methods are...
Ngày tải lên: 05/10/2013, 08:20
... medical aspects Acta Biochim Pol 53, 429–443 21 Steenbergen JN & Casadevall A (2003) The origin and maintenance of virulence for the human pathogenic fungus Cryptococcus neoformans Microbes Infect ... spectrophotometer (Varian Inc., Zug, Swizerland) Kinetic parameters were calculated using prism (GraphPad Software Inc., San Diego, CA, USA) Bioinformatics The molecular mass and theoretical ... idea has been proposed because of similarities in the structures of the C- terminals of the related family of haemocyanins to plant polyphenol oxidases [3] The crystal structure of octopus haemocyanin...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: by nucleotide affinity cleavage: a distinct nucleotide specificity of the C-terminal ATP-binding site potx
... at a final concentration of mM, if not otherwise indicated, and after an additional incubation of 15 at 37 C affinity cleavage was induced by the addition of 0.5 mM FeCl3 and 30 mM ascorbate and ... C Soti et al (Eur J Biochem 270) NAD affected the tertiary–quaternary structure of the Hsp90 homolog of Neurospora crassa [22] Since the available data in the literature is rather sporadic, and ... than with ADP and ADP-like compounds such as alarmones ATP may induce a different conformation of Hsp90 than ADP or alarmones, probably because Hsp90 should adopt a thermodynamically less favored...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
... cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C aL24 0C ⁄ cI7 7C aL24 1C ⁄ cL7 6C aL24 1C ⁄ cI7 7C aL20 7C ⁄ cF5 4C aL20 7C ⁄ cI5 5C aN21 4C ⁄ cA6 2C aN21 4C ⁄ cI6 3C ... ⁄ cI6 3C aN21 4C ⁄ cP6 4C aN21 4C ⁄ cM6 5C aN21 4C ⁄ cI6 6C aA21 7C ⁄ cM6 5C aA21 7C ⁄ cI6 6C aI22 1C ⁄ cG6 9C aI22 3C ⁄ cL7 2C aI22 3C ⁄ cY7 3C aL22 4C ⁄ cL7 2C aL22 4C ⁄ cY7 3C aI22 5C ⁄ cL7 2C aI22 5C ⁄ cY7 3C ++++ ... Cys pair Relative yield of ac cross-linking product (%) aI22 3C ⁄ cV5 8C aI22 3C ⁄ cL5 9C aN23 0C ⁄ cS6 6C aN23 0C ⁄ cT6 7C aN23 0C ⁄ cG6 8C aN23 0C ⁄ cI6 9C aN23 0C ⁄ cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI237C...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt
... characterization of Bacteroides vulgatus cellsurface antigens Acta Microbiol Pol 47, 55–63 12 Fischer, W (1990) Purification and fractionation of lipopolysaccharide from gram-negative bacteria ... Structural elucidation of a capsular polysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease Eur J Biochem 268, 3139–3144 Baumann, H., Tzianabos, A. O., ... length of the fatty acid on the acyoxyacyl group to be mainly 15, confirming the result of the compositional analysis In the minor triacylated lipid A, the fragmentation patterns of the parent ion at...
Ngày tải lên: 31/03/2014, 23:20
A new form of the c metric
... related to the ˜ ˜ is related to the acceleration of the black ADM mass of the non-accelerated black holes and A holes ˜ The fact that G(ξ) is a cubic polynomial means that one in general cannot ... located at r = r± This shows that the parameter A governs the acceleration of the black hole On the other hand, m and e are respectively the ADM mass and electric charge of the non-accelerated ... conformal tensor Recall that those parameters that not appear in the curvature quantities are called kinematic parameters and those that appear in the curvature quantities are called dynamical...
Ngày tải lên: 16/09/2015, 15:43
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
... such as pipes and connection pits in the case of blockage At this stage, the regular maintenance and cleaning of the biogas plant itself was considered unnecessary After the testing period, the ... fermentation chamber with hydraulic chamber, and soak pit The total capacity of the fermentation chamber and hydraulic chamber is about 13 m3 The plant adopts the gravity flow system and no energy ... having the connection of their latrines to biogas plants At the installation, the community agreed to share the 20% of the installation cost and the 100% of cleaning cost of pipes and connection...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... that this evidence establishes that the goods are related The first article indicates that skin toner, cologne and skin cream contain vitamins The second article contains recipes for skin care ... applicant points out, in any likelihood of confusion analysis, two key considerations are the similarities of the goods and the similarities of the marks Tricia Guild Associates Ltd v Crystal Clear ... herbal or organic compounds.” Applicant draws distinctions with regard to how these products are used, their fundamental characteristics, and the channels of trade through which these products move...
Ngày tải lên: 20/12/2013, 23:15
Tài liệu EXPERIENCE OF THE INSTITUTE OF ENERGY IN THE PREPARATION OF THE RENEWABLE MASTER PLAN docx
... (equivalent more than 10 million tons of oil) Types of biomass can be exploited at the industrial scale: rice husks; leaves, top of sugar canes & baggage; coffee husks and wood residues Institute of ... Technical potential > 4000 MW Geothermal energy and other types (tide, ocean waves ) Potential of geothermal energy resources: 200- 340 MW The renewable energy type such as tide and sea waves are ... negligible The Government of VN recognized important role of RE in sustainable energy supplying in general and electricity in particular for rural off-grid areas The electricity Law require support...
Ngày tải lên: 24/01/2014, 03:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... of CBC and Cbl, calculation of k+ We have tested the application of the uorescent analogue CBC as a tool for investigation of the binding kinetics of nonuorescent ligands Cyano-cobalamin (CNCbl) ... absorbance spectra were recorded Concentration of appearing IFCNCbl was calculated by comparison with the standards IFH2OCbl and IFCNCbl according to the equation: IF CNCblt ẳ DA352 ỵ DA361 ị ... expected from the crystallographic data for TCCbl complex [16], and the binding-dissociation curves of CBC and Cbl were identical (Figs 2B,4B Application of a uorescent Cbl analogue and 5B, Table...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx
... 3¢) AS1 AS3 AS3R AS4R a Corresponding peptide GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or ... temperature of 57 C and 58 C, respectively The 5¢ RACE fragment was purified, cloned and sequenced as described above Computer structural analysis The signal peptide and cleavage site of the putative Asterias ... transcriptase (Stratagene) and an oligo-dT primer RACE/PCR, cloning and sequencing A 3¢ RACE/PCR was performed using this cDNA as a template, an oligo-dT primer and a degenerate primer (AS1, Table...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... the C signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the ... atoms of the protein backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated from the chemical shift values of backbone atoms 13Ca, ... spectra of the relaxation rate experiments and the calculation of standard deviations were accomplished using the nlinls procedure The values of R1 and R2 were then calculated from the table of...
Ngày tải lên: 06/03/2014, 11:20
Research Program of the Partnership for a New Generation of Vehicles doc
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... accordance with general policies determined by the Academy, the Council has become the principal operating agency of both the National Academy of Sciences and the National Academy of Engineering in ... metropolitan area) http://www.nap.edu Copyright 2001 by the National Academy of Sciences All rights reserved Printed in the United States of America National Academy of Sciences National Academy of...
Ngày tải lên: 06/03/2014, 15:20
Apollonius of Tyana, the Philosopher-Reformer of the First Century A.D. potx
... rejection of mythology in favour of a physical explanation of natural phenomena Such, for instance, are his explanations of the volcanic activity of AEtna (v 14, 17), and of a tidal wave in Crete, ... protest against the rigid distinctions of caste and race made by Br[ =a] hmanical pride, and to the startling novelty of an enthusiastic religious propaganda among all classes and races in India, and ... Br[ =a] hmans and Buddhists Sarman is the Greek corruption of the Sanskrit Shrama[n. ]a and Pali Sama[n.]o, the technical term for a Buddhist ascetic or monk The ignorance of the copyists changed Sarmanes...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx
... 30 Plant Plant Yeast Plant Bacterium Bacterium Bacterium Bacterium Mammal Mammal Bacterium Bacterium Plant PAL_Ara th PAL_Pha vu PAL_Rho to PAL_mustard PAL_Str ma PAL_Pho lu HAL_Pse pu HAL_Str ... binding ability gradually decreases As homotetrameric PAL contains four catalytically active sites according to the crystal structures [40–42], it is probable that the isolated isoforms of the bean ... Tyr-loop-out conformation which is catalytically inactive and more sensitive to degradation The presence of conformationally stable Tyr-loop-out forms in PAL preparations may, at least partially, account...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf
... Na, Ca, Cb, Cc¢ atoms of the pyrrolidine cycle v1 and v2 torsion angles correspond to the side chain of the prolinoamino acid and are defined by Na, Ca, Cb, Cc and Ca, Cb, Cc, Cd(proR) atoms Ac-Pt3Leu-NHMe ... of SP Conclusion The comparison of conformational spaces of cis- and transprolinoamino acid allows one to access to / and v1 angles Energy calculations can further restrict w and v2 torsion angles ... not affect the overall structure of the peptide backbone and in particular of the core helical region Molecular modeling Conformations of prolinoleucine Minimum-energy conformations of Ac-Pc3Leu-NHMe,...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx
... mathematical models serves as a ÔtoolÕ to facilitate analysis of channelling in biochemical pathways like the urea cycle There is a range of possible molecular mechanisms that may facilitate channelling ... the rate at which CP is produced in the matrix Since the speci c activity of the carbamoyl phosphate produced in the matrix is the same as that of the bicarbonate, only small changes are predicted ... total concentration of bicarbonate was 15 mM but the total concentration of NH4Cl was 0.5 mM So we defined a concentration of CP as 0.5 · 10)3 molÆL)1 and initial concentration of labelled CP as...
Ngày tải lên: 08/03/2014, 08:20
Adventurers of the Far North A Chronicle of the Frozen Seas doc
... regard to the American continent The progress of discovery along the Pacific side of the continent and the occupation by the Spaniards of the coast of California led to a truer conception of the immense ... Fort to the plains of the Saskatchewan After the Treaty of Utrecht had brought peace and a clear title to the basin of the bay, the company endeavoured to obtain more accurate knowledge of their ... Lake; Hearne speaks of it as Athaspuscow Lake The latter name is the same as that now given to another lake (Athabaska of Canadian maps) the word being descriptive and meaning the lake with the...
Ngày tải lên: 08/03/2014, 15:20
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx
... Functioning in accordance with general policies determined by the Academy, the Council has become the principal operating agency of both the National Academy of Sciences and the National Academy ... facility specifically constructed for this purpose The use of aeronautical testing facilities, such as the facilities operated by the National Aeronautics and Space Administration (NASA) at the ... for the National Oceanic and Atmospheric Administration's (NOAA) Hurricane Research Division (HRD), located at the Atlantic Oceanographic and Meteorological Laboratory in Miami, Florida At HRD,...
Ngày tải lên: 08/03/2014, 19:20
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
... how they can clear the rulers of their church of that day of the guilt of that dark transaction The circumstances of the country, therefore, at the time of James's accession were very peculiar The ... in a treatise licensed by Garnet and Blackwall Certain instances are given in the work as illustrations of the doctrine The following is one of these cases A man arrives at a certain place, and ... CHAPTER V CHAPTER V The Proceedings of the Conspirators on the Discovery of the Plot their Capture at Holbeach the Meeting of Parliament 57 CHAPTER VI CHAPTER VI Trial of the Conspirators 67 CHAPTER...
Ngày tải lên: 08/03/2014, 22:20