... during the trading day Australian and New Zealand dollars are credited first, then Japanese yen, followed by the European All training material found in this manual and provided by Trading Intl ... contract on the spot market a bank serving a trader tells the latter the quota – an evaluation of the currency traded against the U.S dollar or another currency A quota All training material found ... neckline This may happen as you measure the average height of the formation All training material found in this manual and provided by Trading Intl L.L.C are held proprietary to Trading Intl and Any...
Ngày tải lên: 10/12/2013, 10:15
... created, and how they have related to other males since childhood The male brain naturally compartmentalizes The male brain tends to find mental multitasking difficult and is set up to naturally ... In their minds, they are the same individual with the same temperament and values in each world But the environment has changed around them, and so they adapt to the rules governing that environment ... just as inescapable in business as the law of gravity is in the physical world (And although I am focusing on the expectations instinctively shared by most men, experienced female readers may see...
Ngày tải lên: 14/03/2014, 18:20
Báo cáo khoa học: " A simple and rapid method for detection of Goose Parvovirus in the field by loop-mediated isothermal amplification" pps
... LAMP assay for detection of GPV infection in goslings Optimal LAMP assay was evaluated by analyzing GPV infected gosling tissues DNA extracted by the tissue Figure Determination of the optimal ... Recommendation of GPV Veterinary Science in China 1962, 8:19-20, (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An outbreak of ... Sichuan Province, China 3Key Laboratory of Animal Diseases and Human Health of Sichuan Province, Yaan 625014, Sichuan Province, China 4College of Animal Sciences, Henan Institute of Science and...
Ngày tải lên: 12/08/2014, 04:21
Tài liệu A Women’s Health Intervention for Gynecological Problems in the Deployed Environment ppt
... of “make shift measures” to urinate • Dehydration (not drinking fluids to prevent urination) Vaginal symptoms: Itching, burning, pain, & discharge Menstrual complaints: Pain, heavy bleeding, ... Does providing women with information on feminine • hygiene and menstrual self-care practices lead to a decrease in genitourinary complaints during deployment? Specific Aims To increase knowledge ... level about feminine hygiene in the deployed environment To determine the effectiveness of an intervention to decrease: • Vaginal & urinary tract symptoms • Menstrual complaints Women in Bureau...
Ngày tải lên: 13/02/2014, 07:20
Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx
... material poverty, and an inability to acquire the material things necessary to live well Environmental poverty in Asia and the Pacific Poverty in Asia and the Pacific is increasingly concentrated in ... generally The latter are those poor people who not live in such marginal areas ADB assumes that in certain rural locations, the primary reason for an inability to escape poverty has to with the natural ... collected by using standard and accepted technical methods Lack of safe water, for instance, is measured according to the criteria put forward by the World Health Organisation, that takes into account...
Ngày tải lên: 05/03/2014, 16:20
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam
... China, Taiwan, Thailand, Laos, Cambodia Products Smoked Bamboo is unique to Vietnam that Xuan Lai Bamboo, GiaBinh From the starting point was to create a competitive advantage for small and medium ... provincial authorities have the main mechanism investment incentives, the province has made the investment environment is relatively transparent and open for business attraction The villages in ... province in the 2009-2015 period 26 CHAPTER ANALYSIS AND DISCUSSION 4.1 Overview of small and medium enterprises in craft villages in Bac Ninh Bac Ninh is a province in the northern plains in the...
Ngày tải lên: 13/03/2014, 14:20
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc
... ATP ⁄ ADP to the guanine nucleotides must be acquired by a cooperative effect of several amino acid side chains Amino acid residues interacting with the guanine moiety of GDP in EhPGK The amino ... efficiencies Therefore, the increased Vmr and decreased Km values for ATP were in agreement with the results obtained for ADP in the forward reaction It is worth noting that although changes in catalytic ... amino acid side chains interacting with the guanine moiety were detected From this structural analysis it became evident that the amino group at carbon of the guanine ring may interact with the...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... eliminate materials in the extracts that bind nonspecifically to the beads After removing the beads by filtration, 200 lg of the nuclear extract proteins were incubated in reaction buffer containing ... nuclear proteins were incubated with a biotinylated MREa oligonucleotide and trapped by avidin– agarose beads The proteins were extracted from the avidin– agarose beads by washing with a buffer ... panel The purified protein bands are indicated by solid arrowheads Fig Microsequencing analysis of the MREa-binding proteins (A) The N-terminal sequence of the 82-kDa band was identical to amino-acid...
Ngày tải lên: 17/03/2014, 23:20
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... managers—that of finding a reliable source of information and keeping an adequate flow of information, so that teams don't rely on the grapevine and look towards their managers to get the information ... moment they get acquired by a larger company, they look for an exit, despite being given top compensation The mai-baap manager The Indian manager has a unique role to play, that of mai-baap (mother-father, ... connected and information can travel faster Also, teams are more distributed, which can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx
... in training data For simplicity of implementation, they are excluded from training data Note that the tagging rules can be used only for generating training data They cannot be used to distinguish ... taken into account in this paper, the feedback corpus contains further useful information For example, we can obtain training data consisting of instances of errors by comparing the feedback corpus ... chicken/mass for dinner where (4) ¢ £¡ (2) Now rules that match the template can be obtained from the training data All we need to is to collect words in from the training data Here, the words in Table...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
... with increasing concentration of TMPTMA up to 15 phr Therefore, in order to obtain PVC having the highest , 0.4 phr of DAPC and phr of TMPTMA can be used in the material Table 2: Linear thermal ... Thermomechanical analysis A thermomechanical analyzer (Mettler TA4000, Switzerland) with a flat-ended, loaded probe (dia mm) is used for thermomechanical analysis PVC samples are heated at 10oC/min from ... crosslinked by DAPC and TMPTMA is higher than that of the uncrosslinked samples It reflects an useful increase in service temperature of the material At any concentration of TMPTMA, a maximum glass transition...
Ngày tải lên: 03/04/2014, 15:20
What I Wish I Knew When I Was 20: A Crash Course on Making Your Place in the World by Tina Seelig
... have the weather clear up shortly after they launched their effort And, yes, one team ran a car wash and another started a lemonade stand, but their returns were much lower than average I count the ... than when asked to pay a fixed price For this team, as well as for the team m aking restaurant reservations, experimenting along the way paid off The iterative process, where small changes are ... set up a car wash or lemonade stand, using the five dollars to purchase the starting materials This is a fine option for those interested in earning a few extra dollars of spending money in two...
Ngày tải lên: 03/04/2014, 18:42
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot
... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622, using...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
... (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., ... Translational Medicine enterprise in Qatar WCMC-Q: Weill Cornell Medical College in Qatar; HMC: Hamad Medical Corporation; SIDRA: a teaching hospital; Safallah: Special Learning and Research Center ... population Weill Cornell Medical College in Qatar’s charge includes a leadership role in the effort to address important biomedical research and healthcare needs in Qatar The main focus of Qatar...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in the ... linear sequential circuit with input memory order m; that is, inputs remain in the encoder for an additional m time units after entering Typically, n and k are small integers, k < n, the information ... using the ABFT A systematic form of convolution codes is especially profitable in the ABFT detection plan because no redundant transformations are needed to achieve the processed data after the...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot
... practicing VAC farming systems is a main issue for the local and central Government Therefore, the Government is strategically putting in an effort to reduce coastal exploitation by identifying ... collect the base line information on the economic status of farmers participating in traditional VAC farming systems in two selected districts of Vietnam The staff from CEDMA have been updated on the ... Abstract The farming communities in the Central coastal areas of Vietnam have very limited productive land, and marine aquatic resources are overexploited The diversification of income base for...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx
... being the change in the personnel from CEDMA, Vietnam The project commencement date was delayed by more than a month as a result of a delay in the initial signing of the contract Mr Mai Van Ha ... of the existing traditional farming systems and managing water quality simultaneously and therefore reducing the environmental impact of their operations To date the project achievements have included ... status of the farmers practicing traditional VAC practices This is achieved by improving the productivity and thus the income base from the traditional VAC system in an environmentally sustainable...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx
... Improved VAC for Farmers in Thanh Hoa Earthworm + Snake head in tanks Earthworm + Snake head in tanks Earthworm + Snake head in tanks Snake head in tanks Snake head in tanks Earthworm Business Earthworm ... Training for two CEDMA staff in Australia Duration: The training in Australia took place between February 13th to March 8th 2010 Venue: Curtin University, Perth, Australia Purpose: Consolidation and ... participants, of which were leaders of the village, extension staff and the remainder were farmers The outcomes from the meetings included that there be an emphasis on minimizing the financial...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt
... convenient location that is, close to manure, away from strong and direct sunlight and in an area not prone to flooding The container floor plays an important role in maintaining the quality of the culture ... Water parameters were within acceptable ranges for fish health and growth Examination of dead fish suggested that the mass mortality of eels one week after stocking was a result of transportation ... Conditions applicable to the improved VAC system; • Suitable for farms where ponds are non-existent or, exist but are of an area less than 200m2 particularly in areas of limited access to water, • Availability...
Ngày tải lên: 21/06/2014, 04:20