polysemy syntax and variation a usage based method for cognitive semantics
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt
Ngày tải lên :
12/08/2014, 17:20
... thousand fewer miR-mRNA interactions Another survey that investigated several traditional predictors including PicTar, TargetScanS, miRanda, and RNAhybrid [8], concludes that miRanda and RNAhybrid ... i.e., TargetScan and DIANA-microT, achieve a relatively low sensitivity and predict a small number of targets The miRanda was shown to provide a substantially better sensitivity as a trade-off for ... simulate that by using a small set of negatives (false targets) For instance, a method by Yan and colleagues filters miRanda's predictions based on 48 positive and 16 negative sites [21] A more...
- 12
- 621
- 0
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx
Ngày tải lên :
12/08/2014, 17:20
... are split according to the value of a single bit In fact we only demand that the data is arranged in some binary tree The match-bits of a given node are computed as all bits that are not a match-bit ... 1998, 38(6):983-996 Swamidass SJ, Baldi P: Bounds and Algorithms for Fast Exact Searches of Chemical Fingerprints in Linear and Sublinear Time Journal of Chemical Information and Modeling 2007, ... bitstrings X and Y The values |A1 |, |A2 |, , |Ak| and |B1|, |B2|, , |Bk| can be used to obtain a tighter bound than Smax Let Ni A B A B Figure shows an example the usage of this notation In the...
- 10
- 372
- 0
Báo cáo y học: "Comparison between Flotrac-Vigileo and Bioreactance, a totally noninvasive method for cardiac output monitoring" ppt
Ngày tải lên :
13/08/2014, 16:20
... of natural intra-patient CO variability and to determine optimally bias and precision Results are summarized in Table When all very stable CO values were averaged for each patient, correlations ... manual data acquisition and averaging of several measurements In addition, we considered PAC-CCO as a reference for accuracy when the PACCCO trend line slope was nearly flat and when the fluctuation ... the manuscript AC, JCD, and PS conceived of the study, performed the statistical analysis, and collaborated to finalize the manuscript All authors read and approved the final manuscript Page of...
- 6
- 408
- 0
Improvement and implementation of analog based method for software project cost estimation
Ngày tải lên :
14/09/2015, 08:40
... Research in chapters to aims to enhance analogy based estimation‟s accuracy For instance, in chapter the adjustment mechanism has been largely improved for a more accurate analogy based method ... et al.1997, Gray and MacDonell 1997, Wittig and Finnie 1997, Gray and MacDonell 1999, Burgess and Lefley 2001, Shepperd and Kadoda 2001, Heiat 2002, Pendharkar and Subramanian 2002, Mair et al ... Algorithm/Programming (Shukla 2000, Burgess and Lefley 2001, Aguilar-Ruiz et al 2001), and Fuzzy Logic (Ahmeda et al 2005, Engel and Last 2007) 2.3.5 Analogy Based Estimation Analogy based estimation (ABE),...
- 239
- 327
- 0
A correlation based method for direction finding of multipath signals in frequency hopping systems
Ngày tải lên :
15/09/2015, 22:51
... the baseband signal, f c is carrier frequency The signal passes through multiple paths, each with a propagation delay and an attenuation factor The delay and the attenuation factor may vary with ... over27 lapping sub-arrays and the steering vectors for sub-arrays are identical up to different scalings, and then take the average of the sub-array covariance matrices The for- ward spatial smoothing ... has a certain geometric shape, and the estimation task is performed by exploiting the data collected at different sensors The uniform linear ar- ray (ULA) and the uniform circular array (UCA)...
- 89
- 337
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
Ngày tải lên :
21/06/2014, 01:20
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison between QDs and superparamagnetic nanoparticle -based ... http://www.nanoscalereslett.com/content/6/1/461 Page of Modification and coupling of superparamagnetic nanoparticle Determine of cutoff value and validation of QDs and superparamagnetic nanoparticle -based hybridization 3-Aminopropyl-trimethoxysilane...
- 9
- 469
- 0
A capillary-based method determining the permeability of sand layer for geothermal applications
Ngày tải lên :
05/09/2013, 17:03
... provide an important basis for analyzing the heat transfer process of BHEs in a sand -based aquifer, and also be applied for other porous materials with the grain diameter of 0.1-0.6mm Theoretical ... the early stage and then can be used to estimate the hydraulic permeability of porous media such as sand layer, glass beads, and other granular solids Figure A typical h − t curve of dry sand ... Figure Diagram of the experimental setup measuring the hydraulic permeability of sand layer based on the CR method 3.2 Data treatment The porosity φ was tested according to the national standard Soil...
- 8
- 449
- 0
Tài liệu Báo cáo khoa học: "A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora" doc
Ngày tải lên :
20/02/2014, 22:20
... m a n judges (El-E3) Evaluator E1 is a native Cantonese speaker, E2 a Mandarin speaker, and E3 a speaker of both languages The results are shown in Figure The average accuracy for all evaluators ... generalize to Asian languages? In Pro- ceedings of Pacific Asia Conference on Formal and Computational Linguistics CHURCH, KENNETH 1993 Char_align: A program for aligning parallel texts at the character ... N candidate evaluation is useful because in a machine-aided translation system, we could propose a list of up to, say, ten candidate translations to help the translator We obtained the evaluations...
- 8
- 426
- 0
Báo cáo khoa học: "Structural Semantic Relatedness: A Knowledge-Based Method to Named Entity Disambiguation" potx
Ngày tải lên :
16/03/2014, 23:20
... structural semantic relatedness measure for named entity disambiguation and evaluate the performance on the standard WePS data sets The experimental results show that our SSR method can significantly ... category information Han and Zhao (2009) leveraged the Wikipedia semantic knowledge for computing the similarity between name observations Bekkerman and McCallum (2005) disambiguated names based ... disambiguation research and evaluation task (WePS1 and WePS2) The HAC produce clusters in a bottomup way as follows: Initially, each name observation is an individual cluster; then we iteratively...
- 10
- 284
- 0
A SELF-ASSESSMENT BASED METHOD FOR POST- COMPLETION AUDITS IN PAPER PRODUCTION LINE INVESTMENT PROJECTS doc
Ngày tải lên :
18/03/2014, 02:20
... significant pulp and paper countries like Germany, Finland and Sweden Newly-planted and fast-growing forests in Asia and South America have turned cheap wood raw material to their advantage, and ... the world forest area) Planted forests and new pulp mills as well as paper mills in Asia and South America have changed pulp and paper supply The world’s demand for paper and paperboard is currently ... possible for e.g company management to define importance for areas and for e.g expert panels to evaluate specific areas This approach also balances the areas of the framework Using this separation,...
- 193
- 852
- 0
A DYNAMIC CRASHING METHOD FOR PROJECT MANAGEMENT USING SIMULATION-BASED OPTIMIZATION doc
Ngày tải lên :
29/03/2014, 23:20
... Haga and Marold (2004), and Haga and Marold (2005) present a series of papers involving heuristic crashing methods for project management utilizing simulation Haga and Marold (2004), propose a ... the application of simulation and operations research methods to the areas of project management and logistics He is a member of IIE, APICS, and SHPE His e-mail address is ... simulation to obtain the average time of each activity, the critical path, and the near critical paths A near critical path in this model is a path which length is smaller than the original completion...
- 7
- 394
- 0
Báo cáo hóa học: " Research Article A Feedback-Based Transmission for Wireless Networks with Energy and Secrecy Constraints" potx
Ngày tải lên :
21/06/2014, 05:20
... Communications and Networking B The PDF of the Random Variable A/ f ∗ Let f ∗ be a random variable that is equal to the maximum among K i.i.d exponential random variables with a parameter λ f If A ... source message against potential attacks The second approach uses more efficiently the available channel feedback and extracts the MUD gain by employing an adaptive PA scheme This adaptive PA adjusts ... 4005–4019, 2008 [23] E Tekin and A Yener, “The general Gaussian multiple-access and two-way wiretap channels: achievable rates and cooperative jamming,” IEEE Transactions on Information Theory, vol 54,...
- 11
- 501
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_2 ppt
Ngày tải lên :
21/06/2014, 07:20
... Develop a team -based organization Create a career path for staff 10 Improve staff-satisfaction evaluations 11 Improve compliance evaluation from broker-dealer 12 Improve client-satisfaction scores ... 1: Create a career path for staff Goal 2: Improve client-satisfaction scores Goal 3: Increase the ratio of optimal clients Goal : Develop a team -based organization Goal 5: Maintain a consistent, ... nationally recognized brand name of our broker-dealer Local presence of a brand 20 PR ACTICE M ADE P ERFECT Expand our insurance, tax-planning, and trust capabilities with existing clients Share...
- 20
- 431
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_3 potx
Ngày tải lên :
21/06/2014, 07:20
... few years ago, we were asked to look at the team -based platform of a wirehouse that was attempting to move away from the individual-producer model that has always been the operating approach of ... hire a writer and possibly a graphic designer to prepare the questionnaire and then pay for printing and mailing the survey, entering the response data, and analyzing the results Advisor Impact’s ... small Once an advisory firm begins to add any staff, it has started to accelerate its growth It will need to monitor and measure performance, coach and counsel people, produce an increasing amount...
- 20
- 315
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_6 pptx
Ngày tải lên :
21/06/2014, 07:20
... driver, and, most important, a communication tool for expressing what’s important to the organization A compensation plan defines the behavior the firm values and will pay for and the behavior it values ... critical that it not reinforce bad behavior Plan Affordability Many factors affect the appropriate level of base compensation and total compensation within a firm, including external benchmarks ... The general manager’s role is to be accountable for implementation of financial management, operations, information technology, and human-capital strategies within the firm Occasionally, depending...
- 20
- 304
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_7 pptx
Ngày tải lên :
21/06/2014, 07:20
... same valuation formula Advantages to firm ! Receives fair market value for the shares ! Presents ownership as a privilege rather than a right Disadvantages to firm No tax advantages Disadvantages ... purchase shares of the company at a discount to fair market value or at book value Shares bought may be a separate nonvoting class The company may also “make a market” by buying back shares at a ... for the owner, and value that’s transferable Unfortunately, many financial advisers are in the dark about these matters That’s because the process so many financial-advisory firms have in place...
- 20
- 295
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_8 pdf
Ngày tải lên :
21/06/2014, 07:20
... Process,” at right) Prepaid expenses also appear as a current asset and are reduced as an asset as they are applied, such as an annual prepaid insurance premium that’s recognized in part each month ... trademarks, and goodwill may be carried on the balance sheet, though there are certain accounting rules for recognizing these assets, which an accountant can explain Assets are placed on a balance ... statements in a way that makes it easier to interpret results At a minimum, you should have a balance sheet and an income statement as described in chapter on financial management and outlined...
- 20
- 367
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_10 pdf
Ngày tải lên :
21/06/2014, 07:20
... terms in the deal Can the practice reward me for both my labor and my risk? In conventional valuation theory, analysts make adjustments for things like personal expenses, compensation, and the true ... be capitalized, not the gross We have seen far too many practices that have a large gross but cannot afford to pay their owners fairly and produce a profit or a return on ownership Is there a more ... that vision The reality for many advisers today is that they must make a quantum leap in how they structure and manage their practices if they’re going to realize their goals Dale Turner, a retired...
- 20
- 402
- 0
Numerical Methods in Finance and Economics A MATLAB-Based Introduction_11 doc
Ngày tải lên :
21/06/2014, 07:20
... Professional services 28 Rent 29 Repairs and maintenance 30 Software and hardware expense 31 Tax and licenses 32 Training and continuing education 33 Travel and entertainment Source: © Moss Adams LLP ... performance coach Source: © Moss Adams LLP Staff Member Date Performance Coach Date Partner Date Evaluated by: Reviewed by: W O R K S H E E T Upstream Evaluation THE FOLLOWING performance evaluation ... in the dollars column ($) Remember that total assets need to equal total liabilities and equity Divide all dollar balances by total assets to arrive at the percentages (%) Dollars and Common...
- 20
- 380
- 0