... assignments, a list of candidate cross- links is given in Table Four of these candidate cross- links have been confirmed by tandem mass spectrometric analyses of the corresponding cross- linked peptides ... Computer-assisted mass spectrometric analysis of cross- links Table Candidate cross- links found in NK1 using BS3 as a crosslinking agent The cross- link candidates are nominated by the VIRTUALMSLAB ... this candidate cross- link fits nicely into the 3-D structure of NK1 (Fig 6) The candidate cross- links in Table suggest crosslinking between the N-terminal part of the protein [Y28 (N-terminus) and...
Ngày tải lên: 07/03/2014, 12:20
... the PCP and condensation or modifying domains) in multidomain NRPS enzymes Materials and methods General Standard procedures were applied for PCR amplification, purification of DNA fragments and cloning ... mutations C60F and C473A were introduced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 (5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- ... C331A and C376S, was generated using primers P8 (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and...
Ngày tải lên: 29/03/2014, 08:20
gold and gilt pots and pins possessions and people in medieval britain apr 2005
... from the island, villas fell into disuse, and towns lost their markets and trade Raiders threatened by land and sea: Irish from the west, Pictish from the north, Frisian, Saxon, and others from ... Medieval History and Archaeology General Editors JOHN BLAIR HELENA HAMEROW Gold and Gilt, Pots and Pins MEDIEVAL HISTORY AND ARCHAEOLOGY General Editors John Blair Helena ... amphoras, and spices and tableware.45 Quantities of finds at two coastal sites, Bantham Bay in south Devon and Meols, a sandy beach near Liverpool, are enough to suggest regularly used landing-places,...
Ngày tải lên: 11/06/2014, 10:23
Báo cáo toán học: "Global cross sections of unitary and similarity orbits of Hilbert space operators " ppsx
Ngày tải lên: 05/08/2014, 15:20
Báo cáo y học: "The aryl hydrocarbon receptor-mediated disruption of vitellogenin synthesis in the fish liver: Cross-talk between AHR- and ERα-signalling pathway" ppt
... 125692/720 and 156166/130) and Biosense Laboratories AS (Bergen, Nor- 20 21 Mommsen TP, Walsh PJ: Vitellogenesis and oocyte assembly Fish Physiology Volume 11 Edited by: Hoar W S and Randall D ... of three independent experiments and their means are shown in the plot diagram β-NF is a weaker ligand of the AHR and its potency as an inducer of CYP1A protein and as an inhibitor of vitellogenesis ... 1, 5, and 10: Cells co-treated with 10 nM E2 and increasing concentrations of TCDD (0.1, 0.5, 1, 5, and 10 nM, respectively) for 12 hrs The PSL values of three independent experiments and their...
Ngày tải lên: 13/08/2014, 13:20
Cross border mergers acquisitions and the legal response of host countries
... - 69 B Cross- border M&As and Anti-Competitive Practices 73 C Cross- Border M&As and Host Countries’ Competition for FDI 76 II The Regulation of Cross- border ... decline of FDI For detailed data of recent trends in FDI and Cross- border M&As, please refer to H Christiansen and A Bertrand, Trends and Recent Developments in Foreign Direct Investment, OECD, ... supply of and demand for cross- border M&As; at the industry level, in the sectors which are characteristic of intensified competition in global market, overcapacity, and/ or deregulation and rapid...
Ngày tải lên: 04/10/2015, 08:00
Arms and the Man
... go off (Commandingly.) Strike a light and let me see you Do you hear? (Another moment of silence and darkness Then she is heard retreating to the dressingtable She lights a candle, and the mystery ... bespattered with mud and blood and snow, his belt and the strap of his revolver case keeping together the torn ruins of the blue coat of a Servian artillery officer As far as the candlelight and his unwashed, ... superciliously, conceiving a poorer and poorer opinion of him, and feeling proportionately more and more at her ease with him) I am sorry I frightened you (She takes up the pistol and hands it to him.) Pray...
Ngày tải lên: 06/11/2012, 14:12
A cross cultural analysis of english textbook for grade 10 and suggestion of supplementary activities for students’ cross cultural awareness
... peoples and cultures; developing students positive feelings and attitudes towards those countries, peoples and cultures and, by doing so, fostering students love and respect of their own language and ... peoples and cultures, developing students positive feelings and attitudes towards those countries, peoples and cultures, and by doing so, fostering students love and respect of their own language and ... categories Geography History Language and Literature Society and lifestyle Nature Fine Arts Hobbies Festivals and Holidays Science and Technology Business and Economy Politics Sports Education...
Ngày tải lên: 07/09/2013, 12:58
Let''''s go 1b _adjectives and cross
... Yes, it is A a little yo-yo B a yo-yo little 20 a round ball A Is it B It is D How old is Andy ? C She D It C yo-yo little D yo-yo C What is D They are ...
Ngày tải lên: 27/09/2013, 17:10
Let''''s go 1b _ U5 - Adjectives and cross
... Yes, it is A a little yo-yo B a yo-yo little 20 a round ball A Is it B It is D How old is Andy ? C She D It C yo-yo little D yo-yo C What is D They are ...
Ngày tải lên: 27/09/2013, 17:10
Digital Signal Cross-Connect and Digital Signal Interconnect Products
... products and services And as networks migrate and expand to include more complex services, reliability and flexibility become even more vital to their success That is why digital system cross- connect ... DSX-3 Rear Cross- Connect Module Rear cross- connect modules have jacks on the front, and equipment cable interface and cross- connect interface connections on the rear of the module Front Cross- Connect ... location to access and monitor network signals The management of equipment cables and cross- connect jumpers is addressed at the DSX-3 bay framework, ensuring an organized and expandable network...
Ngày tải lên: 04/11/2013, 13:15
Tài liệu DSX-1 Digital Signal Cross-Connect and Digital Signal Interconnect Products docx
... products and services And as networks migrate and expand to include more complex services, reliability and flexibility become even more vital to their success That is why digital system cross- connect ... Features Cross- connect panels are available in a variety of cross- connect formats, circuit densities and labeling options The following examples highlight standard product options: Rear Cross- Connect ... panel 103253AE Front (Below) Cross- Connect Front (below) cross- connect panels feature both jacks and cross- connect interfaces on the front of the panel The entire cross- connect field is located...
Ngày tải lên: 10/12/2013, 20:15
A cross culture study on using gestures of vietnamese and american people
... Cross the arms and point 40 60 Arms akimbo 85 15 Others 37 63 As can be seen, the most common hands gestures of Vietnamese and American when being angry are different While the most common hands ... male friends usually shake hands and sometimes with a slight bow When shaking hands, both hands are often used Vietnamese people often shake hands with a lingering handshake which sometimes makes ... countries Shaking hand: A handshake is a short ritual in which two people grasp each other’s right or left hand often accompanied by a brief up and down movement of the grasped hands While its origins...
Ngày tải lên: 11/12/2013, 23:48
A cross cultural study of addressing form in greetings in vietnamese and english
... cultural practices and worldviews and crosscultural skills” Developing cultural competence results in an ability to understand, communicate with, and effectively interact with people across cultures ... greetings in Vietnamese and English and the similarities and differences in using them in cross- cultural communication Method of the Study The first step was to search the library and the Internet ... thinking, belief systems, and world views of people from various cultural backgrounds and thus enhances empathy and mutual understanding Investigating issues concerning cross cultural communication...
Ngày tải lên: 14/12/2013, 00:40
A cross cultural study of giving compliments and responses in english and vietnamese
... II: A cross- cultural study of giving and responding to compliments in English and Vietnamese equivalents Chapter III: Some suggestion for gving and responding to compliments in English and Vietnamese ... teaching and learning to modern way However, here and there still exists the traditional method of learning and teaching language, which focuses on rote memorization of grammatical and lexical ... which stand for four groups “highly advisable, advisable, yes or no and inadvisable” And the last is conducted with the aim to study in specific situations There are two main situations set and ask...
Ngày tải lên: 14/12/2013, 00:41
A cross cultural study of using hedges in refusing a request in english and vietnamese
... metaphor and simile are used in English and Vietnamese idioms and to make some comparisons between English idioms and Vietnamese ones In order to obtain these aims, data and sources are collected and ... the learners and readers to improve their knowledge of English and Vietnamese idioms, especially comparative idioms and help them understand the cultural characteristic of English and Vietnamese ... collected and gathered through reading and selecting numerous English and Vietnamese idiomatic expressions Then, the author categorizes and analyzes data of similes and metaphors in idioms The contrastive...
Ngày tải lên: 14/12/2013, 00:41
Tài liệu Dual BNC Coaxial Cross-Connect Jumpers and Patch Cords doc
... 12' (3.66 m) patch cord with MIDSIZE plug on one end and STANDARD size on the other *See catalog #274 for complete line of coaxial cable and jumpers assemblies, including multi pack equipment ... Quality - Patch plugs; factory installed and tested • RG59 type coaxial cable Catalog Number PCH - _ _ XB- _ Plug Type First End M S B Midsize plug Standard size plug BNC connector Patch Cord ... Patch Cord Length* XXX Length in feet (001 thru 050) Plug Type Second End M S B Midsize plug Standard size plug BNC connector Ordering Example: Catalog Number PCH-MMXB-012: 12' (3.66 m) patch...
Ngày tải lên: 21/12/2013, 07:15
Tài liệu DSX-4F Cross-Connect Jumpers and Patch Cords ppt
... 12' (3.66 m) patch cord with MIDSIZE plug on one end and STANDARD size on the other *See catalog #274 for complete line of coaxial cable and jumpers assemblies, including multi pack equipment ... Quality - Patch plugs; factory installed and tested • RG59 type coaxial cable Catalog Number PCH - _ _ XB- _ Plug Type First End M S B Midsize plug Standard size plug BNC connector Patch Cord ... Patch Cord Length* XXX Length in feet (001 thru 050) Plug Type Second End M S B Midsize plug Standard size plug BNC connector Ordering Example: Catalog Number PCH-MMXB-012: 12' (3.66 m) patch...
Ngày tải lên: 21/12/2013, 07:15