plant growth regulators provide a management option

Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx

Ngày tải lên : 14/03/2014, 10:20

... culture maintenance [6] But use of this suspected carcinogen often create health and safety concerns Alterations in the environmental factors such as nutrient levels, light, and temperature may also ... of growth (based on dry weight) in various cultures is shown in (Table 5) It is apparent that growth was inhibited at a high initial N concentration The highest dry weight reached 11.6 g/L at an ... growth was inhibited at a high initial nitrogen concentration of 80 mM Similarly, the accumulation of total saponin and polysaccharide were also influenced by initial nitrogen concentration in...

6
492
0

Báo cáo lâm nghiệp: "Internal levels of plant growth regulators during in vitro culture of wild cherry (Prunus avium L.)" doc

Ngày tải lên : 09/08/2014, 04:20

... quantified by BA had a Acknowledgments Discussion and Conclusion A relationship between IBA and endo- genous IAA can The technical assistance of P Capelli and R Camelin is gratefully acknowledged ... basoapically distributed in the explants and IAA levels were 20-30 times higher than in explants cultured without IBA, where IAA is apico-basally distributed Epstein and Lavee (1986) reported a transformation ... (Prunus avium L.) Plant Growth Regul 8, 325-333 Leroux B., Maldiney R., Miginiac E., Sossountzov L & Sotta B (1985) Comparative quantitation of abscisic acid in plant extracts by gas-liquid chromatography...

4
324
0

Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

Ngày tải lên : 08/08/2014, 14:22

... semi-arid tropical Africa [8, 9, 17] The Acacia species remain very abundant in savannas and arid regions of Australia, Africa, India and the Americas They generally are dependent on mycorrhizae ... mineral nutrient concentrations [2] This biological effect was demonstrated for other Australian acacia species such as Ectomycorrhization of Acacia holosericea in Senegal A mangium [16] The mean ... Rhizobium-Glomus mosseae sur la croissance de Acacia holosericea et A raddiana Bois et Forêts des Tropiques 198 (1982) 3-15 [8] Cossalter C., Introducing Australian Acacias in dry, tropical Africa In: Turnbull...

6
348
0

Báo cáo khoa học: "Management options for vulvar carcinoma in a low resource setting" pdf

Ngày tải lên : 09/08/2014, 03:22

... Bartholin’s gland adenocarcinoma and one case (9.1%) of basal cell carcinoma of the vulva A case (9.1%) of Paget’s disease of the vulva and case of a sarcoma of the vulva were also noted No cases of ... hospital receives and manages complicated cases mis-managed by traditional healers from all parts of Nigeria Up till 2010, there are no functional facilities for radiation therapy in south-eastern ... Genital tract at ABUTH, Zaria Annals of African Medicine 2006, 5(2):93-96 Siddiqui N: The management of vulval cancer Curr Obstet Gynaecol 2002, 12:97-103 RCOG Publications: Management of vulval...

6
286
0

Báo cáo y học: " Management options for accidental injection of epinephrine from an autoinjector: a case report" doc

Ngày tải lên : 11/08/2014, 17:21

... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... review All authors read and approved the final manuscript Acknowledgements Alain Pécoud is thanked for critically reviewing the manuscript References 10 11 12 13 14 Saff R, Nahhas A, Fink JN: Myocardial ... seen at more than 10 s (Figure 1) His blood pressure was 175/85 mmHg, heart rate 80/minute, and respiratory rate 16/minute Vascular surgeons, anesthetists, and a hand specialist were contacted...

3
256
0

role of plant growth-promoting rhizobacteria in integrated disease management and productivity of tomato

Ngày tải lên : 13/11/2014, 10:28

... R.J., Garland, J .A and Seaman, W.L 1994 Diseases and pest of vegetable crops in Canada The Canadian Phytopathological Society Entomological Society of Canada Canada: 275 pp Pitblado, R.E and Howard, ... hydroxide and Actigard (Ustun, 2004) Early blight (Alternaria solani, A alternata) has been reported from most tomato production areas Alternaria solani is present in England, India, Australia, and ... 1994 Early blight In Howard, R.J., Garland, J .A and Seaman, W.L 1994 Diseases and pest of vegetable crops in Canada The Canadian Phytopathological Society Entomological Society of Canada Canada:...

266
588
0

EFFECTS OF RESIDUAL COD ON MICROBIAL GROWTH KINETICS IN A NITRIFYING UCBR

Ngày tải lên : 05/09/2013, 08:40

... nitrification process Wat Res., 29(3), 953-963 Standard Methods for the Examination of Water and Wastewater (1995) 19th ed., American Public Health Association/ American Water Works Association/ Water ... half saturation concentration, Ks, had a low sensitivity The purpose of a sensitivity analysis is to check if the model parameters can be adequately determined with the aid of the available data ... the values obtained in Phase During Phase 1, the average particle diameter was around 600 µm, while experimental results showed that the diameter of particles in Phase was smaller, approximately...

6
446
0

Tài liệu Lab A: Creating and Configuring a Management Agent pdf

Ngày tải lên : 18/01/2014, 05:20

... the Management Agent box, click Tutorial HR (LDIF) Management Agent, and then click Create The Configure the Management Agent dialog box appears Configure HR MA to place metaverse namespace data ... mmsadmin@nwtraders.msft with a password of password Create an instance of the HR tutorial management agent called HR MA a In the control pane of MMS Compass, click Bookmarks, click Management Agents, and ... 2 Lab A: Creating and Configuring a Management Agent Exercise Creating an HR Management Agent In this exercise, you will use MMS Compass to create and configure the HR tutorial management agent...

5
438
0

Costing the Banking Services: A Management Accounting Approach potx

Ngày tải lên : 06/03/2014, 10:20

... total assets Similarly, Gadner and Lammers (1988) carried out a survey on the application of management accounting between banks and saving and loans associations They selected the 50 largest banks ... Financial Institutions, Pitman Publishing and Financial Times, London MARIGOT, C., SEGARRA, S., TORRADES, P [1988]: Planificación y control en la oficina bancaria, Ed Hispano Europea, Barcelona ... mortgage banking industry", The Journal of Bank Costs and Management Accounting, vol 5, no.1, p 28-37 SANTOMERO, A. M [2000]: "Una panorámica histórica de la teor a de la intermediación financiera",...

20
755
0

Báo cáo khoa học: Plant DNA polymerase k, a DNA repair enzyme that functions in plant meristematic and meiotic tissues docx

Ngày tải lên : 07/03/2014, 15:20

... S., Kasai, N., Shimazaki, N., Takemura, M., Asahara, H., Linn, S., Yshida, S., Matsukage, A. , Koiwai, O., Sugawara, F., Yoshida, H & Sakaguchi, K (2002) A plant phytotoxin, solanapyrone A, is an ... is 5¢-AGCTACCATGCCT GCACGAAGAGTGCGTATTATGCCTACACTGGA GTACCGGAGCATCGTCGTGACTGGGAAAAC-3¢ [3H]dTTP (10 lM; 10 CiÆmmol)1) and enzymes were added as indicated in the ﬁgure legends, and incubated for ... dNTP was analyzed by M urea and 10% PAGE and autoradiography (B) TdT activity was measured under the conditions described in Materials and methods Commercial TdT (Takara) was assayed as a positive...

9
492
0

Báo cáo khoa học: Puriﬁcation of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf

Ngày tải lên : 08/03/2014, 08:20

... trichloroacetic acid The A5 04 was measured and the c-glutamyl hydroxamate produced was quantiﬁed using commercial c-glutamyl hydroxamate as standard Control assays were performed in the absence of ATP ... which was run parallel to each assay The assays which contained ATP in stage I were diluted 100-fold for stage II All assays were performed at least in duplicate NADH oxidase in a desalted, cell-free ... percent of the amount of NADH used in our standard NR assay, and 60% of the amount of ATP in a GS assay, was converted into AMP within 10 at 30 °C by an amount of a Mono Q fraction that appeared to...

7
457
0

Báo cáo "The effect of Cu concentration in soil and phosphorous fertilizer on plant growth and Cu uptake by Brassia juncea L. grown on contaminated soils " doc

Ngày tải lên : 14/03/2014, 15:20

... phosphate in reducing the uptake of Cu by Brassica juncea L 2.2 Sampling and chemical analysis Plant and soil samples were taken and analysed at the harvest time (45 days after sowing) Plant samples ... accumulation in plant The results of the effects of added Cu on plant growth and heavy metal accumulation in Brassica juncea L plants are presented in Table Some heavy metals, e.g Cu, at a low ... phosphate fertilizers have a positive effect on growth of Brassica juncea at all application rates The plant height and biomass of Brassica juncea increase up to 130% and 131% respectively comparing...

5
590
1

Access to Finance and Economic Growth in Egypt: A Study Led By SAHAR NASR docx

Ngày tải lên : 15/03/2014, 09:20

... Din, Chairman of Capital Market Authority (CMA); Mahmoud Abdullah, Chairman of Egyptian Insurance Holding Company; Osama Saleh, Chairman of Mortgage Finance Authority (MFA); Ashraf El Kadi, Deputy ... Deputy Chairman of MFA; and Ziad Bahaa El Din, Chairman of General Authority for Investment and Free Zones (GAFI); as well as Abdel Hamid Ibrahim, Senior Advisor; Mona Zobaa, Advisor; and Ahmed ... colleagues on an earlier draft have also been provided by Noritaka Akamatsu, Roberto Rocha and Ahmed Galal The study also beneﬁted from comments received from Gaiv Tata, S Ramachandran, and Omer...

185
620
0

Waste management options and climate change doc

Ngày tải lên : 23/03/2014, 23:21

... study are not aimed at informing waste management decisions at the local level Table Some environmental impacts of the main waste management options Option All options Landfill Incineration Main ... study evaluates greenhouse gas impacts and private financial costs of the waste management options listed above in the years 2000 and analyses four scenarios for waste management for the year 2020 ... where local factors, such as the availability of existing waste management facilities and duration of waste management contracts, markets for recyclables, geographic and socio-economic factors,...

224
306
0

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

Ngày tải lên : 30/03/2014, 11:20

... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin ... LM, Lacbawan F et al (1999) Familial dementia caused by polymerization of mutant neuroserpin Nature 401, 376–379 Davis RL, Shrimpton AE, Carrell RW, Lomas DA, Gerhard L, Baumann B, Lawrence DA, ... retain its inhibitory activity against the target proteinase Experimental procedures Materials Ni-NTA agarose was from Qiagen (Crawley, UK), HiTrap Q-Sepharose and Ficoll PM70 were from Amersham...

13
494
0

small gtpases and their regulators, part a

Ngày tải lên : 11/04/2014, 10:32

... transformation and has been detected in about 20% of all human tumors Rap proteins (Rap 1A, Rap l B, and Rap2) are Ras-related GTPases that share 53% amino acid homology with Ras and are able to antagonize ... are collected and every other one assayed for Rapl GAP activity The Rapl GAP should elute as a broad peak about halfway through this gradient The peak fractions contain substantial Rapl GAP and ... Ras and Ras-relatcd proteins (A) The four Ras proteins undergo three CAA X-signaled modifications that are catalyzed by farnesyltransferasc, an endoprotease, and methyltransferase H-Ras, N-Ras,...

543
328
0

báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

Ngày tải lên : 19/06/2014, 22:20

... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... commercially available enzyme linked immunosorbent assays (ELISAs; Cayman Chemical, San Diego CA USA) Nitrite assay Cell culture medium was assayed for NO2- by the Griess assay as described [8] Samples ... the labeled samples) Curiously, no major protein carbonylation band assignable to SOD1 was found in any G9 3A- SOD1 astrocyte lysates whereas a major carbonylated protein identifiable as SOD1 was...

9
436
0

GANGRENE – CURRENT CONCEPTS AND MANAGEMENT OPTIONS ppt

Ngày tải lên : 28/06/2014, 05:20

... perineal fascia (Colles fascia) may spread to the penis and scrotum via Buck and Dartos fascia, or to the anterior abdominal wall via Scarpa fascia, or vice versa Perineal fascia is attached ... Estrada Ferrer Part 49 Intestinal Ischemia and Bowel Gangrene 67 Chapter Intestinal Ischemia and Gangrene 69 Vivek Srivastava, Vaibhav Pandey and Somprakas Basu Chapter Segmental Small-Bowel Gangrene ... this fascial layer is known as Scarpa’s fascia Understanding the tendency of necrotizing fasciitis to spread along fascial planes and the fascial anatomy, one can see how a process that initiates...

190
548
0

financial report 2001 results provide a solid foundation for future prospects holcim

Ngày tải lên : 27/07/2014, 16:08

... plant Nagarote grinding plant Apaxco plant Pablo Hidalgo 148 San Carlos grinding plant 0.4 million t of cement Macuspana plant Orizaba plant Ramos Arizpe plant Cementos Boyacá S .A. , Colombia Tecomán ... plant Hejöcsaba plant Trident plant Lábatlan plant GranCem Chicago Shareholding: GranCem Weirton Transbeton AG Shareholding: Holnam Texas Limited Partnership Midlothian plant Tvornica Cementa ... Bernard Kueng 1,853 4.2 million t of cement Lägerdorf plant Rostock plant (terminal) Salzgitter plant Altkirch plant Hansa grinding plant Dannes plant Hardegsen grinding plant Héming plant Shareholdings:...

73
317
0

Báo cáo vật lý: "Selective Oxygenation and Plant-Growth Regulatory Activity of Sesquiterpene Lactones" pot

Ngày tải lên : 07/08/2014, 14:20

... authors are thankful to C B Rawal, Chairman, Rawal Institutions, Faridabad, India for providing laboratory facilities and the Central Drug Research Institute (CDRI), Lucknow, India for spectral analyses ... compound Oxygenation and Plant- Growth Regulatory Activity 104 With the drawbacks of TBHP in mind, attempts were made to bring about allylic oxidations of dehydrocostus lactone and isoalantolactone by ... were washed with water and dried over sodium sulphate (Na2SO4) Evaporation of the solvent afforded a purified compound (1.0 g) that showed satisfactory plant- growth regulatory activity as shown...

9
402
0