planning a software project in software engineering pdf

Tài liệu LECTURE 5: SOFTWARE PROJECT MANAGEMENT - Software Engineering Mike Wooldridge pdf

Tài liệu LECTURE 5: SOFTWARE PROJECT MANAGEMENT - Software Engineering Mike Wooldridge pdf

... 5 Software Engineering • Activities in software project management: – project planning; – project scheduling; – risk management; – managing people. Mike Wooldridge 3 Lecture 5 Software Engineering • ... small and relatively informal to large and very formal. • Developing a project plan is as important as properly designing code: On the basis of a project plan, contracts will be signed and careers ... for software project management. Good project management cannot guarantee success, but poor management on significant projects always leads to failure. Mike Wooldridge 1 Lecture 5 Software Engineering •...

Ngày tải lên: 18/02/2014, 07:20

18 710 3
Applied Software Project Management - SOFTWARE TESTING pdf

Applied Software Project Management - SOFTWARE TESTING pdf

... to make sure that a change to one area of the software has not caused any other part of the software which had previously passed its tests to stop working.  Regression testing usually involves ... executing all test cases which have previously been executed.  There are typically at least two regression tests for any software project. 9 Applied Software Project Management TEST AUTOMATION  Test ... list can indicate specific people who will be testing the software and what they are responsible for. 5 Applied Software Project Management DEFECT TRACKING  The defect tracking system is a program...

Ngày tải lên: 28/06/2014, 07:20

13 901 0
Applied Software Project Management - UNDERSTANDING CHANGE pdf

Applied Software Project Management - UNDERSTANDING CHANGE pdf

... possible to admit that projects go wrong 5 Applied Software Project Management UNDERSTANDING CHANGE Applied Software Project Management 1 Applied Software Project Management HOW TO MAKE CHANGE SUCCEED  Progress ... personally see a practice in place before they will accept its value  Especially common in small teams facing growing pains 7 Applied Software Project Management COMMON EXCUSES: YOU CAN’T GIVE ... always be evaluated rationally 2 Applied Software Project Management PREPARE YOUR ORGANIZATION  “We’ve always done it like this.”  Be positive about the work that’s already being done  Take...

Ngày tải lên: 28/06/2014, 07:20

15 403 0
Tài liệu The Five Most Dangerous Issues Facing Sales Directors Today, and How to Guarantee a Permanent Improvement in Sales Results pdf

Tài liệu The Five Most Dangerous Issues Facing Sales Directors Today, and How to Guarantee a Permanent Improvement in Sales Results pdf

... Limited who has dedicated the last 13 years to the development of sales managers and salespeople for many large international organizations. Research Findings ©TRAINIQUE LTD AND THINK TRAINING INC. 2004 ... ©TRAINIQUE LTD AND THINK TRAINING INC. 2004 13 ● HUGE DEMANDS ON SALESPEOPLE The fact is that selling in today’s climate is both an art and a science. Sales is a profession that demands a far ... inertia—among managers and salespeople alike—and implementing the process. ©TRAINIQUE LTD AND THINK TRAINING INC. 2004 10 According to Giles Watkins, Global Competence and Learning Manager, Shell...

Ngày tải lên: 20/12/2013, 19:15

29 699 1
Báo cáo khoa học: "Factorizing Complex Models: A Case Study in Mention Detection" pdf

Báo cáo khoa học: "Factorizing Complex Models: A Case Study in Mention Detection" pdf

... denote the original training data, and T  denote the additional train- ing data. For the all -in- one model, the additional training data cannot be incorp orated directly; this is an in- herent deficiency ... the ACE training data (called T in Section 3.4) is consistent with the additional training data T  : the annotation guidelines for T  are the same as for the original ACE data, but we only labeled ... ACE’04 evaluation. 1 Introduction Information extraction is a crucial step toward un- derstanding and processing natural language data, its goal being to identify and categorize impor- tant information...

Ngày tải lên: 08/03/2014, 02:21

8 554 0
Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

Prevalence of presumed ocular tuberculosis among pulmonary tuberculosis patients in a tertiary hospital in the Philippines pdf

... Bouza et al. [7]. Frequency of finding s was tallied, and significance was assessed by various statis- tical analyses with alpha set at 0.05. A hospital research committee approved the study, and ... participants. He also drafted the manuscript. VO examined participants suspected to have presumed ocular TB and was the one to confirm a patient as having presumed ocular TB. He also gave invaluable ... patients in a tertiary hospital in the Philippines. Journal of Opthalmic Inflammation and Infection 2013 3:1. Lara and Ocampo Journal of Opthalmic Inflammation and Infection 2013, 3:1 Page 4 of 4 http://www.joii-journal.com/content/3/1/1 ...

Ngày tải lên: 15/03/2014, 03:20

4 517 0
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf

... biased against its extra-hepatic functions. In this study, I examined the PPARa agonist-induced proteins in the intestine, another important organ for lipid metabolism e xpressing a fairly large amount ... more outstanding than those o f two typical PPAR a- target gene transcripts, liver-type fatty acid binding protein (L-FABP) and intestine-type fatty acid binding protein (I-FABP) mRNAs [3,21]. ... their mRNAs in intestine slowly increase during a few days of feeding a diet containing Wy14 643. This slow time course of induction is also the case for the intestine-specific PPARa-target gene I-FABP...

Ngày tải lên: 16/03/2014, 18:20

6 272 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

... installed in the area, and than this place was changed in dynamics way of land use system • The forest area was destroyed by increasingly shifting cultivation and rubber plantation areas • Lack ... was created by overlaid of three physical information (Ground data, GIS data and satellite imagery data) • The zonation can be regarded as a tool for sustainable agricultural development in ... Supervised classification Training area (AOI) • Supervised classification – Maximum likelihood method The training area from two images 345, and 2ndvi7 in the1999 and 2004 – classified to 11 classes...

Ngày tải lên: 17/03/2014, 11:20

24 897 0
ADOBE DIRECTOR 11.0 CREATE A BASIC MOVIE IN DIRECTOR DI pdf

ADOBE DIRECTOR 11.0 CREATE A BASIC MOVIE IN DIRECTOR DI pdf

... arranged to form a graphic. The fourth cast member in the cast is a bitmap that will serve as a background for your animation. Because the animated scene will start in frame 15, you will place ... span of an animation It may seem that the tire is bouncing too rapidly. To make the animation run at a slower rate, you can add frames to the animation. You should also keep the separation between ... has taken up the first available slot in the Cast window. The new cast member has adopted the file name from “tire.png” as the cast member name. Animate the image to travel up You are now ready...

Ngày tải lên: 24/03/2014, 01:20

37 611 1
A Dressing Method in Mathematical Physics pdf

A Dressing Method in Mathematical Physics pdf

... as well as in classical and quantum linear problems. In this case matrices are parameterized by a variable x and D can be a derivative with respect to this variable or a combination of partial ... introduced in [317] (see again [324]) un- der the name “binary.” The binary transformations in [317, 324] are a 2+1 construction based on alternative Lax pairs. This is a combination of the classical ... relations and recall basic facts of matrix factorization in terms of dressing procedures. 1.6.1 Example It was shown that a factorization (1.5) yields the intertwining relation (1.1) automaticall...

Ngày tải lên: 28/03/2014, 10:20

405 279 0
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... 22:477-481. 32. Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody-forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/or subcuta- neous administration. ... Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific IgA antibodies in protection against influenza. Vaccine 1990, 8:479-485. 31. Tamura SI, Asanuma H, Ito Y, Hirabayashi ... Y, Hirabayashi Y, Suzuki Y, Nagamine T, Aizawa C, Kurata T, Oya A: Superior cross-protective effect of nasal vaccination to subcutaneous inoculation with influenza hemagglutinin vaccine. Eur...

Ngày tải lên: 18/06/2014, 18:20

14 516 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

... 1960 (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG canus fam EcoRI BamHI (1809) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 ... initiation site. -20 -9 +1 +10 GCGGGTTCAAAAACTACTATAGGTAGGCAG Drosophila TGCCTTATATGTTCGTCTGTAGGAGCGAGT Chicken GCATGTGCGGGCAGGAAGGTAGGGGAAGAC Xenopus TATTGTACCTGGAGATATATGCTGACACGC Rat TATTGGACCTGGAGATAGGTACTGACACGC ... occurs in the MDCK pol I containing fragment. pAD4000 (3100 bp) bla a II SV40 p I Canine p II CMV ori t I CGACCT CCGAAGTT GGGGGGGAG AGT CTT CT CGA GT AGAAG ACC GA CCT ACCT GGCAACAAAAAAT GT GCTGGAGGCTT...

Ngày tải lên: 20/06/2014, 01:20

12 627 0
Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf

Báo cáo hóa học: " The happiness of people with a mental disorder in modern society" pdf

... Gureje, O, Haro, JM, Kawakami, N, Karam, A, Levinson, D, Medina Mora, ME, Oakley Brown, MA, Posada-Villa, J, Stein, DJ, Adley Tsang, CH, Aguilar-Gaxiola, S, Alonso, J, Lee, S, Heeringa, S, Pennell, ... only involve interventions at the individual level, but also social reform. In Layard’s view mental disorders are part and parcel of modern market economies. He calls for taming the rat race and ... disorder in non-capitalistic societies. In a large international comparison in 18 high and low income countries Bromet et al. (2011) finds that depression can be expla ined by personal social circumstances,...

Ngày tải lên: 21/06/2014, 06:20

6 340 0
Population Balances in Biomedical Engineering pdf

Population Balances in Biomedical Engineering pdf

... typically increase with increasing substrate con- centrations, ī must depend on substrate concentrations in such a way that increasing substrate concentrations bring about this shift toward younger ... negative. 1.3 The Age Population Balance Derivation of the age population balance is particularly easy and will be done first to illustrate the general concept of a particle balance. We can obtain ... for- mulate a balance equation for crystals that grow and break in a crys- tallizer. Common to all population balances of this type is that they describe the dynamics of a population of particles in...

Ngày tải lên: 27/06/2014, 10:20

173 294 0
w