place the label inside a group container with horizontallayout
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
Ngày tải lên :
20/02/2014, 02:21
... 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ ... 5¢-GGAATTCGCTGAACTGAGAGGTTAG-3¢ 5¢-CGGGATCCAGCAGTATGGTGTCCGTG-3¢ 5¢-GGAATTCACCGTCACTTCGCTTGAG-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCAGGGTGTCATAGGCCA-3¢ 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ ... 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-GATGTACCAGTTCTTCTG-3¢...
- 8
- 434
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
Ngày tải lên :
07/03/2014, 12:20
... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A FEBS Journal 273 (2006)...
- 11
- 548
- 0
báo cáo hóa học: " Glrt-Based Array Receivers for The Detection of a Known Signal with Unknown Parameters Corrupted by " docx
Ngày tải lên :
21/06/2014, 00:20
... estimates of the noise covariance matrix with more variance when primary data are used More precisely, the variance of the noise covariance matrix estimate and then the associated performance ... R(nT), C(nT), s TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR No TNAR available R, C on sec data TNAR available R, C on sec + prim data No TNAR - 29 - Receivers ... still available in addition to the primary observation vectors and may correspond to samples of data associated with adjacent channels, adjacent time slots or guard intervals For these reasons,...
- 45
- 467
- 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
Ngày tải lên :
08/08/2014, 14:23
... edges a, b are in the same triangle; (2) edges a, c are in the same triangle In the first case, edges c, d are in the same triangle In this case, apply the same replacement as in Figure 36 In the ... signed adjacency matrix B = B(T ) that reflects the combinatorics of T The rows and columns of B(T ) are naturally labeled by the arcs in T For notational convenience, we arbitrarily label these arcs ... is an oriented adjacency graph derived from the signed adjacency matrix associated to an ideal triangulation, defined as follows: Definition We associate to each ideal triangulation T the (generalized)...
- 45
- 262
- 0
báo cáo khoa học: "The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report" ppt
Ngày tải lên :
10/08/2014, 23:20
... Germany Authors’ contributions KN performed the dissection and gave final approval for submitting the manuscript GT and KV analyzed the data and wrote the manuscript JK performed the dissection and ... et al.: The cadaver of a Caucasian man with a supernumerary fourth dorsal interosseous muscle in the right hand: a case report Journal of Medical Case Reports 2011 5:393 Submit your next manuscript ... and made the final review All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: 18 April 2011 Accepted: 18 August...
- 2
- 221
- 0
báo cáo khoa học: " Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome" pptx
Ngày tải lên :
11/08/2014, 11:21
... APETALA3, PISTILLATA, AGAMOUS, SEPALATA3, CLAVATA1, MYB21, MYB24, RBCS-1B, SBPase, a- glucosidase, ß-hexosaminidase, aminopeptidase, acid phosphatase and ß-glucosidase are presented as obtained with ... gibba with some vascular plants (Arabidosis thaliana, Populus trichocarpa and Oryza sativa (indica/ japonica)) Additional file 4: Table S3 - Expression profile matrix of U gibba genes Reads-counts ... genome comparison of Arabidopsis thaliana, Brassica napus, Carica papaya, Nicotianan tabacum and Vitis vinifera and the homologous region from Utricularia gibba (B) Mitochondrial genes identified...
- 16
- 434
- 0
Báo cáo hóa học: "Research Article A Hardy Inequality with Remainder Terms in the Heisenberg Group and the Weighted Eigenvalue Problem" docx
Ngày tải lên :
22/06/2014, 11:20
... Napoli and J P Pinasco, “Eigenvalues of the p-Laplacian and disconjugacy criteria,” Journal of Inequalities and Applications, vol 2006, Article ID 37191, pages, 2006 [11] J Jaroˇ, K Takaˆi, and ... Applications [9] J L V´ zquez and E Zuazua, The Hardy inequality and the asymptotic behaviour of the heat a equation with an inverse-square potential,” Journal of Functional Analysis, vol 173, no 1, pp ... Hardy inequality with remainder terms on Ω, based on the careful Journal of Inequalities and Applications choice of a suitable vector field and an elementary integral inequality Note that we also...
- 24
- 296
- 0
Báo cáo hóa học: "Research Article A Hardy Inequality with Remainder Terms in the Heisenberg Group and the Weighted Eigenvalue Problem" pot
Ngày tải lên :
22/06/2014, 11:20
... Napoli and J P Pinasco, “Eigenvalues of the p-Laplacian and disconjugacy criteria,” Journal of Inequalities and Applications, vol 2006, Article ID 37191, pages, 2006 [11] J Jaroˇ, K Takaˆi, and ... Applications [9] J L V´ zquez and E Zuazua, The Hardy inequality and the asymptotic behaviour of the heat a equation with an inverse-square potential,” Journal of Functional Analysis, vol 173, no 1, pp ... Hardy inequality with remainder terms on Ω, based on the careful Journal of Inequalities and Applications choice of a suitable vector field and an elementary integral inequality Note that we also...
- 24
- 260
- 0
Báo cáo y học: " The MATISSE study: a randomised trial of group art therapy for people with schizophrenia" pdf
Ngày tải lên :
11/08/2014, 16:22
... the data was extracted from, rated each extract as coming from either an Art Therapy group or an activity group Measures At baseline, demographic and clinical data were collected including; age, ... were also asked to record the art materials made available and used by the group, and for activity groups facilitators were asked to record the principal activities pursued All art therapists and ... agreed that a patient has left the group the facilitator should notify the trial coordinator who will make a note that there is a space in the group that can be filled by another study participant...
- 9
- 344
- 0
Báo cáo y học: " Repetition and severity of suicide attempts across the life cycle: a comparison by age group between suicide victims and controls with severe depression" ppsx
Ngày tải lên :
11/08/2014, 17:20
... American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders Fourth edition Washington, DC, USA" American Psychiatric Association; 1994 Motto JA: Suicide attempts A ... into account Female and male controls appear to become less suicidal with age In the female group repetition is reduced and in the male group the severe attempt rates are reduced Second, we compared ... by Marzuk et al [50] and been associated with actual suicide attempts [51] Severe suicide attempts are similar to serious attempts as defined by Motto [40] as well as Beautrais [52] that is a need...
- 7
- 310
- 0
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
Ngày tải lên :
25/10/2012, 11:18
... 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation ... the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting ... vasodilatation before undergoing their initial and final angiograms The glycoprotein IIb/IIIa inhibitor (Tirofiban) was administered at the operator’s discretion All patients maintained anti-platelet...
- 6
- 550
- 0
How Is the Ku Klux Klan Like a Group of Real-Estate Agents
Ngày tải lên :
17/10/2013, 18:20
... let the niggers know the war is over and that the Klan is back on the market.” Atlanta had by now become Klan headquarters The Klan was thought to hold great sway with key Georgia politicians, and ... Klan and Real-Estate Agents the typical online dater is either a fabulist, a narcissist, or simply resistant to the meaning of “average.” (Or perhaps they are all just pragmatists: as any real-estate ... users actually earn that much, suggesting that three of the four big earners were exaggerating Male and female users typically reported that they are about an inch taller than the national average...
- 30
- 550
- 0
Getting the Most from a Class Discussion Group
Ngày tải lên :
02/11/2013, 18:20
... sure each person speaks within a time limit A recorder or secretary writes down what each person says and reads back the notes to the group after everyone has spoken GETTING THE MOST FROM A CLASS ... so that you’ll both know you mean the same thing COMING TO A CONCLUSION After each person has spoken, the recorder reads back what each person said and the group considers how they see the same ... tell her what you thought she said and then ask her if that was what she meant As you are speaking, repeat a word or phrase that she used Pay close attention to her response as you speak If she...
- 6
- 503
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
Ngày tải lên :
22/02/2014, 07:20
... results are however, in accordance with the results of Hasegawa et al [13] who questioned the paraphyly of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms ... NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer...
- 9
- 671
- 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
Ngày tải lên :
06/03/2014, 08:21
... (This data was obtained with the commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f1 R is an integral domain Let S be the subring of R generated ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... tools, the central idea will always be to count fields by counting integral points on certain associated varieties, which are related to the invariant theory of the Galois group These varieties...
- 20
- 478
- 0
Finanzgruppe Deutscher Sparkassen- und Giroverband: Inside the Savings Banks Finance Group pptx
Ngày tải lên :
06/03/2014, 10:20
... imited activity on the capital L market on the assets side Retail banking Sound capital base Inside the Group | Savings Banks Finance Group 14 Inside the Group he Savings Banks Finance Group ... international market activities ooperation within the Group increases operational efficiency C Rather than being a group of affiliated companies, the Savings Banks Finance Group comprises around ... commercial banks Decentralised Group structure allows for market proximity and operational efficiency Savings Banks Savings Banks form the heart of the Group They are regional retail banks with total...
- 28
- 404
- 0
A JOINT PROJECT OF THE AMERICAN ACCOUNTING ASSOCIATION AND THE ACCOUNTING PROGRAMS LEADERSHIP GROUP pdf
Ngày tải lên :
06/03/2014, 21:20
... of the AAA/AAPLG Ad Hoc Committee to Assess the Supply and Demand for Accounting Ph.D.s 23 Age Table 14 shows age groupings, again separated by the two major national origin categories Of the ... Students as a Percentage of the Total United States 51.7 Canada
- 63
- 458
- 0
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx
Ngày tải lên :
14/03/2014, 13:20
... 1997 K J Falconer, Fractal Geometry, Mathematical Foundations and Applications,John Wiley & Sons, 1993 A Fan, K S Lau and S M Ngai, Iterated function systems with overlaps, Asian J Math 4(2000), ... Describle the local dimension for the (0, 1, a) - problem, where a ∈ N is a natural number Note that the local dimension is an important characteristic of singular measures For a = 3k + the measure ... questions related to Probability, Fractal, Wavelets, East - West J of Math Vol 2, No 1(2000), 55-71 J C Lagarias and Y Wang, Tiling the line with translates of one tile, Inventions Math 124(1996),...
- 14
- 387
- 0
A Brief Memoir with Portions of the Diary, Letters, and Other Remains, potx
Ngày tải lên :
16/03/2014, 01:20
... of learning came: in it I learned this, that, and the other; but, alas! order, the faculty in which I am so deficient, was wanting, I had not an appointed place for each fact or idea: so they ... dedication The separation, as R.B said, from the right hand and the right eye must be made: the sacrifice which is acceptable will always cost something 3d Mo 8th Oh, may I become altogether a babe ... world; at another, filling me with impatience and anxiety about my spiritual progress; at another, with self-confidence, and at another, with despondency Oh, the enemy knows my many weak sides;...
- 95
- 517
- 0
A study in the growth mechanism of silicon nanowires with or without metal catalyst
Ngày tải lên :
16/03/2014, 15:09
... formed With more and more Si atoms added, the Si content in the If the growth with a metal catalyst can cause contamination, the synthesis without metal will be useful for obtaining clean samples with ... Metal-assisted growth of SiNWs A basic aspect of the VLS mechanism is the metal particle acting as a catalyst for the anisotropic growth of SiNW with a crystalline structure A catalyst particle ... flowed away by the protected gas to an area with lower temperature (B in Fig 4A) When temperature decreases, the Si atoms are easier to reach saturation in quasi-liquid Si/SiS2 and precipitate The...
- 5
- 576
- 0