pl sql code that derives the return date of a rented item
Tài liệu Using SQL *Plus to Create Report and Manage Pl/SQL code doc
Ngày tải lên :
17/01/2014, 09:20
... by a run character, either a semicolon (;) or a slash (/) Add the format-clearing SQL* Plus commands after the run character As an alternative, you can call a reset file which contains all the ... with the SQL* Plus PRINT command Syntax VARIABLE variable [NUMBER|CHAR|CHAR(n)|VARCHAR2(n)] PRINT variable where: variable n is the name of the bind variable is the maximum length for the datatype ... even a Start the LABS\pcmsg .sql file to execute the PL/ SQL block b Enter a value at the prompt Sample values are 3, “hello”, “NULL”, and c Display the value in the G_MESSAGE global variable SQL> ...
- 50
- 370
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of...
- 18
- 494
- 0
Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc
Ngày tải lên :
31/03/2014, 01:20
... weaken the comparative evaluation of stabilities of the same enzymes, which follows later The N-terminal His-tag causes formation of an active StP tetramer Preparations of His-tagged StP that ... to the dimer and containing approximately 85% of the total protein, and another fraction that accounted for the remainder protein and displayed a molecular mass of 360 kDa, as expected for a StP ... phosphate is bound The comparison of Kd values for enzyme-sulfate complexes of wild-type and the two Arg fi Ala mutants reveals that a direct participation of the side chains of Arg234 or Arg242...
- 11
- 444
- 0
SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR STRESS
Ngày tải lên :
24/08/2014, 11:45
... PI3-K, paxillin, talin, and p130Cas FAK’s activation and association with these signaling molecules initiates the PI3-K pathway, ERKpathway, and the c-Jun NH2-terminal kinase (JNK)-pathways (Schaller ... classroom and imparting invaluable wisdom about the art of teaching v ABSTRACT Julia M Hum SIGNALING MECHANISMS THAT SUPPRESS THE ANABOLIC RESPONSE OF OSTEOBLASTS AND OSTEOCYTES TO FLUID SHEAR ... levels increase, PKC is activated and induces phospholipase A2 to cleave arachidonic acid from the plasma membrane (Kudo and Murakami, 2002; Murakami and Kudo, 2002) Arachidonic acid is converted...
- 134
- 134
- 0
cash cycle factors that influence the desired level of cash optimal cash inventories
Ngày tải lên :
31/10/2014, 15:29
... that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas are inputs to a cash budget and how they affect the ... Learn about the Cash Cycle • Understand the factors that influence the desired level of cash • Learn two models that calculate the optimal level of cash • Gain an overview of what factors/areas ... Organization Collection and disbursement of funds Netting of interagency payments Investment of excess funds Optimal level of cash balances Cash planning and budgeting Bank relations Treasury Management...
- 33
- 460
- 0
Study on the elements that affect the buying decision of milk bottle DR brown in new generation company limited
Ngày tải lên :
10/12/2015, 00:12
... Tran Research design a Data collection (Secondary and Primary data collection) Primary data is information which the author gather by himself and secondary data is information gathered by others ... investigate In the secondary data, the author use to gather data and facts about the retailers and retailers’ customers and markets from different websites, retail stores b Data analysis: The questionnaire ... which are popular and analyses and validated in the past research From that synthesis, Phuoc uses them into applying his research proposal on the topic: the elements affecting buying decision of A4 ...
- 33
- 196
- 0
Study on the elements that affect the buying decision of milk bottle DR. Brown in new generation company limited
Ngày tải lên :
05/10/2016, 20:13
... Maloni and W.C Benton (1999), in awareness can make to increased profitability evaluation Brand awareness has great their research stated that the power source of the supplier, once overrun the ... being complained and being praised, as well as what makes consumers happy about the Quantity approach: this method permits us measure and analysis the data in the real product or what are their ... technology ability, implementation ability which are Brand consciousness popular and analyses and validated in the past research From that synthesis, Phuoc uses them into applying his research proposal...
- 17
- 333
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... about a multinational join stock company’s product quality or the quality of the maintenance work that its staff have done, but has complained about the late reply and maintenance service of the ... and the theory that will be later based on to research The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one Gaining...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the default None ... Third Case Assume the following: • • • Cascade Update Related Fields is unchecked UpdateRule is set to None The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... on the activity of the enzyme and cytochrome c reduction was followed over (Vs) for a range of sample dilutions (200 lL sample per reaction) The slope of a plot of the reciprocal of the sample ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate that the...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... subsites and the position of the cleavage site can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... (PDB code: 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0