pestis a potential agent of bioterrorism

Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx

Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx

... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India Introduced ... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... the availability of sufficient genetic variability 1981-IRRDB germplasm collection – a valuable reservoir of genes for various abiotic stresses Acre : Brasileia, Feijo, Sena Madureira, Tarauaca,...

Ngày tải lên: 21/02/2014, 04:20

23 573 0
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf

báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf

... therapy, with a surrogate marker, may have additional value as particularly effective immunomodulatory activity, such as that observed with natalizumab, may have a potential downside [26] that ... labeled anti-beta2 microglobulin (L368) for sHLA-I and L.2.03 Mab for sHLA-II were added to each bead and incubated for an additional hour at 45°C After additional washes, the color reaction was started ... the analysis of variance J Amer Statist Assoc 1937, 32:675-701 Stone LA, Frank JA, Albert PS, Bash CN, Calabresi PA, Maloni H, McFarland HF: Characterization of MRI response to treatment with...

Ngày tải lên: 19/06/2014, 22:20

6 424 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt

... (’moderate akathisia’) Fluvoxamine (50 mg, twice a day) was administered Substantial relief of akathisia was noted on day of fluvoxamine treatment The dose of aripiprazole was increased to 24 ... with antipsychotic treatment Aripiprazole is an antipsychotic drug that acts as a partial agonist at dopamine D receptors and serotonin 5hydroxytryptamine (5-HT) 1A receptors, and an antagonist at ... was increased to 12 mg His global score on the Barnes Akathisia Scale was Administration of fluvoxamine (50 mg, twice a day) rapidly improved the akathisia He showed no signs of akathisia after...

Ngày tải lên: 08/08/2014, 23:21

3 404 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

... transplantation of cartilage In vivo analysis in rabbits repair by synovial mesenchymal stem cell transplantation in rabbits (a) Cell transplantation on a cartilage defect in a rabbit by the local adherent ... were analyzed using a grading system consisting of five categories (cell mor- 15 aTotal smooth area of the reparative cartilage compared with the entire area of the cartilage defect bAverage thickness ... cartilage Mostly hyaline cartilage Mostly fibrocartilage Mostly non-cartilage Noncartilage only Matrix-staining (metachromasia) Normal (compared with host adjacent cartilage) Slightly reduces Markedly...

Ngày tải lên: 09/08/2014, 10:23

10 470 0
Báo cáo y học: "Alkylating HIV-1 Nef - a potential way of HIV intervention" ppsx

Báo cáo y học: "Alkylating HIV-1 Nef - a potential way of HIV intervention" ppsx

... spectrometry analysis Far-UV CD measurement at 20°C was made on an Aviv 202 CD spectrometer (Lakewood, NJ) in the department of chemistry of NYU Data were the average of 4-6 accumulations, using scanning ... HIV-1 activity Our finding suggests that TPCK can serve as a prototype of a class of drugs that retains the Cys55 modification activity but has desired pharmacodynamic and pharmacological properties ... of 418 Da, exactly Page of 10 equal to that of a one TPCK-alkylated Cys Thus, the collective MS data proved that TPCK alkylates Cys55 and Cys206 but not Cys142 or any His residues TPCK alkylation...

Ngày tải lên: 10/08/2014, 05:21

10 428 0
Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps

Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps

... this article as: Shimamoto: Polyurethane sheet: A potential substitute of surgical cotton gauze Journal of Cardiothoracic Surgery 2011 6:26 Submit your next manuscript to BioMed Central and take ... polyurethane sheet This study indicates that the blood absorption power of the polyurethane sheet is equivalent to that of the cotton gauze even after repeated use, and it has the potential to decrease ... warranted, polyurethane sheets may function as a substitute of conventional surgical gauze, thus facilitating a more efficient surgery Competing interests None: Dr.Shimamoto has no commercial...

Ngày tải lên: 10/08/2014, 09:23

2 237 0
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx

báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx

... 5’-ggggAgCTCTCAATTgAATTgTggTTgTTCC-3’ SacI H4-H1 cloning H1*H4F 5’-gTTggAggTgTAAAAAATAgggAgCCAgC-3’ H1*H4R 5’-TATTTTTTTAgCACCTCCAACTgATTgAgTAgg-3’ H4-WCT-R 5’-CCCgAgTCTCTATTCTTCACCgCTgCCAC-3’ SacI H4WCT ... gCgggATCCTAAggCCATCCCCAgAAAg 3’ BamH1 ATHB1 cloning ATHB1WCTR 5’ gCggTCgACTACTCTTgTTTgCCCTgAAgC 3’ Sal1 ATHB1WCT cloning ATHB1CTF 5’ gCggAATTCCAAgAgACAgCTAATgAACCA 3’ EcoRI ATHB1 CTR cloning Genomic DNA Sequence of ... 5’-CAgTggACTCgTACTTgTTCTTgT-3’ Genomic DNA UBC9GENOM-F 5’-gTTTTggAAATgTTgACAggAC-3’ ATHB1F 5’ gCggAATTCATggAATCCAATTCgTTTTTC 3’ EcoRI ATHB1 and ATHB1WCT cloning ATHB1R 5’ gCgggATCCTAAggCCATCCCCAgAAAg...

Ngày tải lên: 11/08/2014, 11:21

19 355 0
Báo cáo y học: "Celiac disease as a potential cause of idiopathic portal hypertension: a case report" pdf

Báo cáo y học: "Celiac disease as a potential cause of idiopathic portal hypertension: a case report" pdf

... Sama SK, Bhargava S, Nath NG, Talwar JR, Nayak NC, Tandon BN, Wig KL: Noncirrhotic portal fibrosis Am J Med 1971, 51:160-169 Ichimura S, Sasaki R, Takemura Y, Iwata H, Obata H, Okuda H, Imai F: The ... malaise, anorexia, diarrhea, abdominal pain and weight loss He had not been compliant with a GFD in the past year despite our recommendation Abdominal CT scan showed splenomegaly, thickening of ... microsomes (ALKM-1), antimitochondrial antibody (AMA), and anti-liver cytosol antigen antibody (ALC-1), were negative The serum gammaglobulin level was normal A gluten free diet was advised At a month...

Ngày tải lên: 11/08/2014, 20:20

4 270 0
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf

báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf

... sequence TTGAC TTGAC(C/T) TTGACC TTGACT TTTGAC(C/T) TTGACA CACGTG TGACG ACCGACA (A/ G)CCGAC GCCGCC CC (A/ T)6CG CATGTG (A/ C)TCC (A/ T)ACC TAAC(G/C)GTT TAACTAAC A( A/C)C (A/ T )A( A/C)C GGATGTA CCAAT Observed ... bacterial blight caused by Xanthomonas oryzae pv oryzae (Xoo) and fungal blast caused by Magnaporthe grisea through activation of salicylic acid (SA)-dependent pathways and suppression of jasmonic acid ... Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K: Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription...

Ngày tải lên: 12/08/2014, 03:20

12 182 0
Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

... Oxidation of HVA in the presence of HRP to a fluorescence dimer 69 3.11 A standard calibration plot for the HVA assay 70 3.12 A standard calibration plot for the HPAA assay 74 3.13 Structure of ABTS ... gives a diagrammatic summary of the activation of MAPK signaling pathways ROS production by activated neutrophils and macrophages is a vital component of host organism defense; the phagocytic isoform ... that application vii LIST OF TABLES Page 1.1 Nomenclature of reactive species found in vivo 1.2 Biomarkers of oxidative stress/damage associated with some human diseases 14 1.3 Data of urinary...

Ngày tải lên: 22/10/2015, 21:14

165 397 0
Báo cáo y học: "Behavioral and antioxidant activity of a tosylbenz[g]indolamine derivative. A proposed better profile for a potential antipsychotic agent" pptx

Báo cáo y học: "Behavioral and antioxidant activity of a tosylbenz[g]indolamine derivative. A proposed better profile for a potential antipsychotic agent" pptx

... shows antioxidant activity a) The Polar Surface Area (PSA) of a molecule is defined as the area of its van der Waals surface that arises from oxygen and nitrogen atoms as well as hydrogen atoms attached ... Validation of a computational procedure for the calculation of the polar surface 23 24 25 26 area (PSA) of organic compounds Pharmazie 2002, 57(9):652-653 Clark DE: Rapid calculation of polar ... [g]indol-7-amine (TPBIA) and 5-OH-DPAT A novel antipsychotic agent with a mechanism of action different from all currently marketed typical and atypical Page of (page number not for citation purposes) Annals...

Ngày tải lên: 08/08/2014, 20:23

7 400 0
Synthesis of Pichromenes, a Potential Anticancer Agent Using Organocatalyst

Synthesis of Pichromenes, a Potential Anticancer Agent Using Organocatalyst

... maintaining the temperature at 100C A white pasty mass appeared soon After all of the alkaline solution was added, the pasty mass was disolved with 60 mL of cold water The product is precipitated ... proton at 6,64 ppm and 8,03 ppm in 1HNMR spectrum Therefore, we had to change the condition and use other catalysts L-proline is an amino acid which has a chiral center, making it a potential enantioselective ... enantioselective catalyst 20 mol % of this catalyst was used for the condensation reaction in DMF/water at room temperature for days In 1H-NMR spectrum of crude reaction mixture, a small amount of the desired...

Ngày tải lên: 24/06/2015, 08:17

7 321 1
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana

Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana

... and technology (KNUST) generates a colossal amount of waste (solid and liquid) The solid waste is dumped at a site far away from the inhabited part of campus and the liquid waste is sent to a ... biogas potential of the sewage at the Primary Sedimentation Tank (PST) at the KNUST sewage treatment plant and its potential power production Feedstock analysis 2.1 Wastewater handling at KNUST ... Poliafico M Anaerobic Digestion Support Software, Cork Institute of Technology, 2007 [7] Barelli D., Csambalik L., Mestas C and Santos D Economical and Environmental Analysis of a Biogas Plant...

Ngày tải lên: 05/09/2013, 16:11

8 880 1
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...

Ngày tải lên: 18/02/2014, 16:20

12 657 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc

... Wada, A. , Ogo, S., Watanabe, Y., Mukai, M., Kitagawa, T., Jitsukawa, K., Masuda, H & Einaga, H (1999) Synthesis and characterization of novel alkylperoxo mononuclear iron(III) complexes with a ... dismutase or catalase, implicating the involvement of a peroxo adduct in catalysis [243] In fact, reactivity was enhanced when H2O2 was the oxidant in place of reductant and air [243], and the putative ... iron-peroxy adduct prone to fragmentation [266] A similar paradigm also appears to apply to the nal step in aromatase (CYP19)-catalyzed biotransformation of androgens to estrogens [267] As illustrated...

Ngày tải lên: 19/02/2014, 16:20

26 747 0
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... mm tall) The bottom of this chamber was a single layer of acoustically transparent latex A single layer of acoustically transparent polypropylene mesh was held in place approximately cm above ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison...

Ngày tải lên: 05/03/2014, 17:20

15 967 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

... transport offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and ... that Canadian and North American data is particularly scarce Sustainability 2011, 335 Table Dairy—summary of organic vs conventional comparisons Authors Main [56] Olesen et al [59] Bos et al ... Manitoba, Canada Sask, Canada Pelletier et al [28] Canada Robertson et al [33] US Pimentel et al [32] US Type of study Comparative field trial Comparative field trial LCA (of conversion) Comparative...

Ngày tải lên: 08/03/2014, 23:20

41 524 1
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx

... Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou Caribou Caribou Caribou Caribou Caribou Caribou Conant silt loam Conant silt loam Conant silt loam Daigle silt loam ... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine...

Ngày tải lên: 08/03/2014, 23:20

131 599 0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc

... separate individual domains: D1, MfeI and XhoI; D2, XhoI and AatII; D3, AatII and AvrII PCR using Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and ... CTC AGG CAG TCT CCT ATG TTC AGA TGG GCC TTC GCC TCC GG GTC CTG ATC CTG CTC CTA CCC GGG CCC GGG CCC GGG CAG GAC CAG GAT TAG GAG TAA GTG CAA GTC CAA GTC GTC CTT TGG CCT AGC CCT AGG AGG ATG GGG ACG ... enzymatic standardization (for PCr) and spectrophotometric standardization (for ADP) Magnesium acetate was added to a concentration of mm above the concentration of ADP to ensure full saturation of...

Ngày tải lên: 16/03/2014, 06:20

9 569 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

... cross-peaks was used for a conservative estimation of the maximum distances and classification of cross-peaks as weak, medium and strong For the calibration of the intensities of the NOE peaks, a statistical ... indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared ... statistical analysis of the daN(i,i+3) signals of residues 11–30 was performed using typical values for an ideal a- helix [13] The a- helical structure of this part of the peptide is clearly evident...

Ngày tải lên: 16/03/2014, 16:20

10 426 0
w