perspective of a natural scientist

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Ngày tải lên : 15/06/2014, 09:26
... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper ... Conversion and Management 64 (2012) 301– Table Absolute error and uncertainty of measured parameters 70 Measured parameter Absolute error Inlet air flow rate Diesel fuel flow rate Natural gas flow rate ... mode This is because of the very lean mixture of gaseous-fuel and air at part load, and the associated poor fuel utilization efficiency In such a case, large portion of natural gas escapes from the...
  • 12
  • 573
  • 0
Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

Báo cáo lâm nghiệp: "Conversion of a natural broad-leafed evergreen forest into pure plantation forests in a subtropical area: Effects on carbon storage" pps

Ngày tải lên : 08/08/2014, 00:22
... (Cunninghamia lanceolata) plantation forest; FH, Fokienia hodginsii plantation forest; OX, Ormosia xylocarpa plantation forest; CK, Castanopsis kawakamii plantation forest; NF, natural forest of C kawakamii ... Castanopsis kawakamii, and an adjacent relict natural forest of Castanopsis kawakamii (NF) that as a control, provided a unique opportunity to examine how changes occur following converting a natural forest ... lanceolata (Chinese fir, CF), Fokienia hodginsii (FH), Ormosia xylocarpa (OX) and Castanopsis kawakamii (CK) that grown on a same soil and with the same former forest, natural forest of Castanopsis...
  • 10
  • 384
  • 0
Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

Báo cáo y học: "Distinctive receptor binding properties of the surface glycoprotein of a natural Feline Leukemia Virus isolate with unusual disease spectrum" pps

Ngày tải lên : 13/08/2014, 01:20
... 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, 2) the mutant designated VRB3aa using primer 5’-GAGGGAGTAATCAGGACAATAGCTGCACAGGAAAATGCAACCCCC-3’, 3) the mutant designated N147S using primer 5’-GGGAGTAGTCAGGACAATAGCTGTGAGGG-3’, ... indicated primers where the introduced mutation in each case is underlined: 1) the mutant designated 61E/945-5 using primer 5’ACTAGTGTTGGATCCTAACAACGTTCGGCATGGAGCTAGGTATAGCAGTAGCAAATATGGATGTAAAACTACAGATAG-3’, ... mutant designated K128N/S130T using primer 5’GCAACCCCCTAGTCTTACAGTTCACCCAGAAGGGAAGACAAGCCTCTTGG-3’, 5) the mutant designated I156V/K164R using primer 5’-GGAGAAGCTTGGTGGAATCCCACCTCCTCATGG-3’, and...
  • 17
  • 267
  • 0
Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Báo cáo y học: "Whole genome sequencing of a natural recombinant Toxoplasma gondii strain reveals chromosome sorting and local allelic variants" ppsx

Ngày tải lên : 14/08/2014, 21:20
... S, Rajandream MA, Saunders D, Seeger K, Whitehead S, Mayr T, Xuan X, Watanabe J, Suzuki Y, Wakaguri H, Sugano S, et al.: Common inheritance of chromosome Ia associated with clonal expansion of ... II and III, predominate across Europe and North America [7,8] As data become available from wider geographical studies it is evident that higher levels of allelic variation and clonal expansion ... comments on the paper and read and approved the final manuscript 10 11 12 Additional data files The following additional data are available with the online version of this paper: graphs showing the...
  • 17
  • 324
  • 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Ngày tải lên : 12/09/2015, 08:20
... Characterization of flavonoids on PPARα and PPARγ activity 103 3.3 Characterization of flavonoids and PPARα ligands on a natural PPARα V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... 2004 at Shanghai International Convention Center, Shanghai, China xiv ABBREVIATIONS 15dPGJ2 Å3 ABCA1 ACO Acrp30 AD AF-1 AF-2 AM aP2 apoA-I apoA-II apoA-V apoC-III AR bp Bio Cal CAP350 CARM-1 ... AGGTCA-NN-AGGTCA VDR DR-3 AGGTCA-NNN-AGGTCA TR DR-4 AGGTCA-NNNN-AGGTCA RAR DR-5 AGGTCA-NNNNN-AGGTCA Members of the NR superfamily share a common structural organization that is well-defined and...
  • 263
  • 267
  • 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

Ngày tải lên : 18/12/2013, 10:08
... proclaim state years of sabbatical years of rest ultimate/ eventual final attain reach persistent constant swift fast anew again edifice of character set of character thereof of it, whose Table ... 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining solemnity as well as the leadership of the speaker Here is an account of the most notable ... integrated way as simultaneously a mental, social, cultural, institutional and political phenomenon Language has been seen now as not only a practice but also reflection of reality People have also...
  • 44
  • 578
  • 0
Tài liệu MARKETING PLACES- CONCEPTS ABOUT A PLACE UNDER THE PERSPECTIVE OF MARKETING PLACES pdf

Tài liệu MARKETING PLACES- CONCEPTS ABOUT A PLACE UNDER THE PERSPECTIVE OF MARKETING PLACES pdf

Ngày tải lên : 16/01/2014, 11:37
... Create an advantage Act early to take advantage of structural changes Sustain the advantage Global competition Competitive advantage of companies in global industries $ $ $ 57 Competitive strategy ... about a place political crisis… - Economic, financial, and under the perspective of Marketing Places c/ Characteristics of a place A place in terms of administrative geography may have several ... cultural, historical and national elements − A central city and surrounding residential areas − A market with identifiable attributes − A base for local industry, and an agglomorate of quasi industrial...
  • 32
  • 513
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Ngày tải lên : 16/02/2014, 14:20
... p300 are general transcriptional co-activators that contain histone and transcription factor acetylation activities [30] In addition, CBP contains a number of protein-binding domains that mediate ... and A Patel of cell fate Leukemias associated with loss -of- function or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I,...
  • 11
  • 761
  • 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Ngày tải lên : 20/02/2014, 18:20
... information about the semantic structure of concepts associated with English words, particularly verbs For example, the verb abridge has an associated case frame consisting of an agent doing the abridging ... straightforward, and the resulting complex of resources executes without any performance problems in a multi-user environment The task of a developer of a particular natural language application is greatly ... client-server architecture, for use with a general-purpose natural language understanding system The conversion of resources such as Comlex and WordNet into a format usable by our system was straightforward,...
  • 5
  • 416
  • 0
Working PaPer SerieS no 1272 / DeCeMBer 2010: THe iMPaCT of PuBliC guaranTeeS on Bank riSk Taking eviDenCe froM a naTural exPeriMenT pptx

Working PaPer SerieS no 1272 / DeCeMBer 2010: THe iMPaCT of PuBliC guaranTeeS on Bank riSk Taking eviDenCe froM a naTural exPeriMenT pptx

Ngày tải lên : 15/03/2014, 10:20
... deviation of the average return of assets, E stands for equity, and A for total assets.22 The latter two are used to calculate the capital assets ratio (E /A = CAR) ROAA and CAR are both averages ... federal state bank is a liated with a state (“Bundesland”) or group of states The a liated savings banks own each a part of their federal state bank The federal state banks act as regional clearing ... Dummy variable for removal of government guarantees (after removal of state guarantees) Aggregated total assets of groups of savings banks Downgrade of federal state bank in numerical rating notches...
  • 53
  • 1.4K
  • 0
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx

How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx

Ngày tải lên : 15/03/2014, 16:20
... of water sanitation plans The National Water Supply and Sanitation Plan (Planasa) was institutionalised in 1971 during the military regime to guarantee financial resources transfers to Sanitation ... July 2010] Agencia Nacional de Aguas (ANA) [Online] Available at: http://www.ana.gov.br/prodes/prodes.asp [Accessed at 12 July 2010] Asia News 2010 [Online] Availabe at: http://www.asianews.it/news-en/Ethnic-unrest-in-Guangxiover-water-pollution-by-industrial-plant-18941.html ... such as China and Brazil have accelerated the process of industrialisation and urbanisation Although China has a central government, both countries have opted to great process of decentralisation,...
  • 36
  • 481
  • 0
Báo cáo khoa học: Binding of non-natural 3¢-nucleotides to ribonuclease A ppt

Báo cáo khoa học: Binding of non-natural 3¢-nucleotides to ribonuclease A ppt

Ngày tải lên : 16/03/2014, 18:20
... pH of the water wash was % 13) Glacial acetic acid (0.5 mL) was added, the layers were separated, and the organic layer was washed again with water The layers were separated, and the organic layer ... addition, the antineoplastic drug fludarabine is an arabinonucleoside, and the antineoplastic drug clofarabine is a 2¢-fluoro-2¢-deoxyarabinonucleoside We find that araUMP (as well as dUFMP) binds ... (M + Na): 527.1180 (observed), 527.1195 (calculated) Arabinouridine 3¢-phosphate (araUMP, 10) The preparation of 10 was carried out in a manner similar to that used for the preparation of 5a The...
  • 12
  • 576
  • 0
Báo cáo khoa học: A metabolomics perspective of human brain tumours pdf

Báo cáo khoa học: A metabolomics perspective of human brain tumours pdf

Ngày tải lên : 23/03/2014, 09:21
... (1981) Classification of human cancer cells by means of capillary gas chromatography and pattern recognition analysis J Chromatogr 217, 231–237 Sugita Y, Yamada S, Sugita S, Sakata K, Morimatsu M ... types can be described by maximally four ICA components (Fig 1A, for an example) [44] Available ICA algorithms are capable of handling standard in vivo MRS data which still possess significant unavoidable ... of brain tumours [42] It has become evident that there are additional relevant aspects available from 1H MRS data for patient management It has been shown that the volume of metabolic abnormality...
  • 8
  • 418
  • 0
Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf

Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf

Ngày tải lên : 24/03/2014, 05:21
... relations of a sentence But what about the logical relations? Recall that each clause has a unique head end that the functional features of each phrase are identified with those of its head For ... property that the functional features of each phrase are identified with those of its head The head category of a phrase is characterized by d~e assignment of the trivial ft~%ctional-equation and by ... (O~J)" A ~mED 'A~ m~C~ NU~ SG~ ) It is composed of grammtical ftmction naras, s~antic forms and feature symbols The crucial elements of LFG (in contrast to transformational g~n.ar)are the grammticel...
  • 6
  • 476
  • 0
Báo cáo " Adventurous tourism-a potetial realm of world Natural Heritage - National Park Phong Nha - Ke Bang " ppt

Báo cáo " Adventurous tourism-a potetial realm of world Natural Heritage - National Park Phong Nha - Ke Bang " ppt

Ngày tải lên : 28/03/2014, 15:20
... inside, along a way filled with stalactites of various shapes Some stalactites droop down like the hair of a fairy, some stalactites elsewhere gather together like an ethereal palace, some stalactites ... uphold around (Fig 5a) This place is also an excellent dwelling place for deers, stags, tigers and gayals Taking another path, tourists can pay a visit to Thung Tre - a vast forest zone of about ... industry, has fascinated tourists near and far Nevertheless, tourism potentials in this place are limitless Aprart from serving the tourists who take advantage of their time to enjoy natural beauties,...
  • 12
  • 251
  • 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

Ngày tải lên : 29/03/2014, 11:20
... that an airman is capable of tolerating Additional applications, such as the use of the processed electromyography (EMG) signal as a measure of muscle fatigue and pain as well as an analysis of ... easily prepared by anodic treatment, resulting in electrode plates that have a dc resistance greater than GΩ and a capacitance of 5000 pF at Figure 1.10 Block diagram of a typical capacitive active ... primarily of dead, dried-up cells which have a high resistance and capacitance For a 1-cm2 area, the impedance of the stratum corneum varies from 200 kΩ at Hz down to 200 Ω at MHz Mechanical abrasion...
  • 478
  • 522
  • 2
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx

Ngày tải lên : 30/03/2014, 16:20
... contraction of a random coil protein Proc Natl Acad Sci USA 95, 9268–9273 51 Arakawa T & Timasheff SN (1984) The mechanism of action of Na glutamate, lysine HCl, and piperazineN,N¢-bis (2-ethanesulfonic ... reaction was initiated by adding m glutamate, 10 mm MgCl2 and mm GTP and the intensity of light scattering was monitored for 15 at 37 °C Effect of TMAO on the GTPase activity of FtsZ A standard malachite ... 273, 669–676 22 Mandal AK, Samaddar S, Banerjee R, Lahiri S, Bhattacharyya A & Roy S (2003) Glutamate counteracts the denaturing effect of urea through its effect on the denatured state J Biol Chem...
  • 13
  • 599
  • 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

Ngày tải lên : 05/06/2014, 11:23
... vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 ... must name all the numerical ranks beyond a koti (ten million, i.e., 107), each rank being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, ... Oda, Larry Pfaff, Donald Ranee, Andrew Ranicki, Aamir Rehman, Abdulhamid Sabra, Brian A Sullivan, Daniel Tenney III, Alf van der Poorten, Jared Wunsch, Michio Yano and Don Zagier Finally, I can't...
  • 238
  • 5.2K
  • 0
it doesn't take a rocket scientist, great amateurs of science - malone

it doesn't take a rocket scientist, great amateurs of science - malone

Ngày tải lên : 05/06/2014, 11:29
... a celestial object on a scale and of an importance that even professionals usually can only dream about For an amateur like David Levy, having his name attached to it was the culmination of a ... wrinkled are really a matter of shape In her view, and that of other specialists, a mistranslation from the German is at fault, and what Mendel was really looking at were actual shapes, round and angular ... streaks An ion, or gas, tail may also develop, and these tails can change their appearance rapidly, just as the coma itself may send off spectacular jets of erupting material Because very large...
  • 231
  • 162
  • 0
a place for consciousness probing the deep structure of the natural world nov 2004

a place for consciousness probing the deep structure of the natural world nov 2004

Ngày tải lên : 11/06/2014, 10:40
... obstacle to the challenge of naturalizing the mind 1.3 Liberal Naturalism Even though I argue against physicalism, I am a naturalist The view I favor is Liberal Naturalism I view naturalism as a ... understand causation itself Perhaps the metaphysics of causation is richer than materialists usually suppose I devote part II of the book, “Faces of Causation,” to a direct analysis of causation and ... in a coherent and natural way by a single set of fundamental laws However, like substance dualism, Liberal Naturalism holds that some of these properties and laws are not physical properties and...
  • 344
  • 1.3K
  • 0