personality traits are essential for a complete clinical science

Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf

Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf

... PFOR has been described for anaerobic bacteria such as Bacteroides [26], D africanus [25,27] and several anaerobic human parasites from the genera Entamoeba [11], Trichomonas [20] and Giardia ... glycolytic and fermentative enzymes and pathway uxes in live parasites Results Kinetic characterization of EhPFOR in amebal extracts PFORs in several anaerobic parasites have been found attached to plasma ... prepared extract; the reaction was started by addition of 0.2 mm acetyl-CoA Basal activity with NADH and the extract was always subtracted Complete inhibition of the ADH activity with pyrazole was...

Ngày tải lên: 15/03/2014, 23:20

14 420 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated from separate measurements (three for ... substrate Isothermal titration calorimetry (ITC) was used to compare the affinity of CoA to wild-type thiolase and its C8 9A variant The results obtained (Fig and Table 3) indicate that the affinity ... AcAc-SPP [3]; for example, Km and kcat are 73 lm and 469 ⁄ s for AcAc-SPP, whereas they are 24 lm and 465 ⁄ s, respectively, for AcAc-CoA In the crystal structure, the binding modes of the reactive...

Ngày tải lên: 16/03/2014, 04:20

13 473 0
Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc

Báo cáo khoa học: The b-N-acetylglucosaminidases NAG1 and NAG2 are essential for growth of Trichoderma atroviride on chitin doc

... ATCAGATGGCGATGTGAAGAG ACCAAGAGTTGAGCCCGTC TCTTGGGCCCTGATACAGACAC AGTTTGGGCCCTGCGAGTTTG TGGCATACAGACTGGGCG AGAACTCGGCTCCATAGGC TTGAAGAAGAGCTGCGAG TGAATGAGGATACACGGG TGGATGTTTGAGTGAGCGG (Roche, Indianapolis, ... microscopical analysis of hyphal growth and branching patterns did also not reveal any differences among the analysed strains (Fig S3B), indicating that the NAGases NAG1 and NAG2 are not essential for ... characterization of their phenotypes Dnag2-I and Dnag2-II are Dnag2 strains C2332 and A5 23, and nag1Dnag2-I and nag1Dnag2-II are Dnag1Dnag2 strains 713 and 1921, respectively Chitin degradation in...

Ngày tải lên: 23/03/2014, 05:22

12 457 0
Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

Báo cáo y học: " Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" docx

... were gated as CD3+ cells, and apoptosis was quantified as the mean percentage of Annexin V and 7AAD+ cells from the total number of gated cells Statistical analysis Statistical analysis was performed ... before (c) and after (d) treatment (original magnification × 125) (e) Results from image analysis of synovial biopsy sections for active caspase-3 and TUNEL staining before and after intra-articular ... correction for multiple comparisons of paired samples for the synovial biopsy data In vitro data were analyzed by one-way analysis of variance followed by Tukey post hoc analysis or nonparametric...

Ngày tải lên: 09/08/2014, 01:22

9 304 0
Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf

Báo cáo y học: "Monocytes are essential for inhibition of synovial T-cell glucocorticoid-mediated apoptosis in rheumatoid arthritis" pdf

... were gated as CD3+ cells, and apoptosis was quantified as the mean percentage of Annexin V and 7AAD+ cells from the total number of gated cells Statistical analysis Statistical analysis was performed ... before (c) and after (d) treatment (original magnification × 125) (e) Results from image analysis of synovial biopsy sections for active caspase-3 and TUNEL staining before and after intra-articular ... correction for multiple comparisons of paired samples for the synovial biopsy data In vitro data were analyzed by one-way analysis of variance followed by Tukey post hoc analysis or nonparametric...

Ngày tải lên: 09/08/2014, 13:22

9 397 0
Báo cáo y học: " Treatment of forefoot problems in older people: study protocol for a randomised clinical trial comparing podiatric treatment to standardised shoe advi" potx

Báo cáo y học: " Treatment of forefoot problems in older people: study protocol for a randomised clinical trial comparing podiatric treatment to standardised shoe advi" potx

... entrance examination will be made available to the expert panel Sample size There are no evidence-based estimates for clinically important change in assessing forefoot pain or for Page of clinically ... words “as normally as possible” Everyone will have at least two practice runs per foot before the actual measurements are made Participants are asked to look straight ahead to prevent targeting; ... FFI-5pts has been translated into Dutch and validated for similar participants as an interview schedule The FPDI has been validated for participants with foot problems but was not yet available in...

Ngày tải lên: 10/08/2014, 21:24

8 330 0
Connecting the dots in asia pacific how business leaders are preparing for a world where everything is connected

Connecting the dots in asia pacific how business leaders are preparing for a world where everything is connected

... concerns in Asia-Pacific may be attributed to a lack of awareness For instance, executives representing data-reliant sectors such as financial services (49%) and professional services (40%) are far more ... in Asia-Pacific agree that investments aimed at capitalising on the potential benefits of greater Figure 1: All change Importance of an organisation’s ability to adapt its people, processes and ... respondents are based in AsiaPacific with a majority located in India (15%), Australia (14%), China (14%), Japan (10%) and South Korea (10%)  About one-half of the survey respondents (49%) work for...

Ngày tải lên: 04/12/2015, 00:03

14 253 0
Báo cáo khoa học: " Pro/con clinical debate: Isolation precautions for all intensive care unit patients with methicillin-resistant Staphylococcus aureus colonization are essential" pps

Báo cáo khoa học: " Pro/con clinical debate: Isolation precautions for all intensive care unit patients with methicillin-resistant Staphylococcus aureus colonization are essential" pps

... possible and as important as it ever was Con: No, isolation precautions for all ICU patients with MRSA colonization are not essential Geoffrey Bellingan To reduce the spread of MRSA, I agree that universal ... Critical Care June 2004 Vol No Farr and Belligan studies have concluded that it is less expensive to pay for detection and control than it is to use inadequate measures and let MRSA spread [4,7] Randomized ... that universal precautions, including gloves, hand-washing, disposable aprons, cleaning equipment and the environment, and regular surveillance cultures, are important and all are practiced in...

Ngày tải lên: 12/08/2014, 20:20

4 234 0
Tài liệu The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice Second Edition pptx

Tài liệu The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice Second Edition pptx

... federal government now plays a greater role as a result of the Health Insurance Portability and Accountability Act (HIPAA) Privacy and Security Rules that are in force In addition, each mental health ... either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many practitioners: a way to schedule appointments or answer a ... considers that each state has its own professional ethical standards, and national and state mental health organizations create, augment, and interpret published public ethical standards differently...

Ngày tải lên: 15/02/2014, 02:20

577 4,7K 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* ... pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )140 to )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA...

Ngày tải lên: 19/02/2014, 16:20

18 509 0
Tài liệu The wisdom of coaching: Essential papers in consulting psychology for a world of change pot

Tài liệu The wisdom of coaching: Essential papers in consulting psychology for a world of change pot

... that are covered by the American Psychological Association Virtually all of the books that have appeared in the same time frame are ignored by that database Thus, it appears that the field is accumulating ... human behavior, and the psychodynamic aspects of organizational and managerial life and the lack of practical guidance for how consultants and coaches can and should work with executives and managers ... PREPARE FOR A PRACTICE AS A PROFESSIONAL EXECUTIVE COACH Professional executive coaches are not born As described above, it is a specialty of organizational consultation that requires a complicated...

Ngày tải lên: 21/02/2014, 16:20

384 1,1K 0
Báo cáo khoa học: Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast potx

Báo cáo khoa học: Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast potx

... Glugea plecoglossi (BAA11470), Ashbya gossypii (AAS53513), Candida albicans (CAA70857), Schizosaccharomyces pombe (CAB58373), Neurospora crassa (AAK49353), Gibberella zeae (XP_389750), Aspergillus ... (EAL63212), Cyanidioschyzon merolae (BAC67668), Guillardia theta (AAK39722), Parachlorella kessleri (P28996), Chlorella pyrcnoidosa (BAE48222), Beta vulgaris (CAB09900), Arabidopsis thaliana (AAF02837), ... Miyazawa K, Yamaguchi K, Nowaki K, Iwatsuki H, Wakamatsu Y, Ichikawa N & Hashimoto T (2001) Deletion of mitochondrial ATPase inhibitor in the yeast Saccharomyces cerevisiae decreased cellular and...

Ngày tải lên: 07/03/2014, 05:20

13 424 0
Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

Báo cáo khoa học: Replacement of two invariant serine residues in chorismate synthase provides evidence that a proton relay system is essential for intermediate formation and catalytic activity docx

... exchanged are in bold): S1 6A, forward primer, 5¢-CGACCTATGGCGAGGCGCACTGCAAGTCG3¢, and reverse primer, 5¢-CGACTTGCAGTGCGCCTCGC CATAGGTCG-3¢; S12 7A, forward primer, 5¢-GCGGCCG CTCTGCCGCCCGCGAGACC-3¢, ... Ser16Ala 0.012 1.38 NcCS Ser127Ala 0.14 NcCS Ser16Ala Ser127Ala Below detection limit 16.1 a Chorismate synthase activity compared with wild-type NcCS activity with an absorbance maximum at around ... synthase caused a substantial decrease in activity beyond the detection limit of our assay In contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) the Ser16AlaSer127Ala double-mutant...

Ngày tải lên: 07/03/2014, 05:20

10 399 0
A Complete Guide for All Ages: Easy to understand information from the nation’s leaders in women’s health doc

A Complete Guide for All Ages: Easy to understand information from the nation’s leaders in women’s health doc

... you’re an African American, Hispanic, American Indian/Alaska Native, Asian American, or Pacific Islander woman, you’re more than twice as likely as a Caucasian woman to get type diabetes What is ... be given another chance at life You are your own best advocate and you deserve to be heard Lois La Habra, California 34 The Healthy Woman: A Complete Guide for All Ages For More Information… Office ... coronary artery disease The Healthy Woman: A Complete Guide for All Ages Heart Attack: Warning Signs Many people think a heart attack is sudden and intense, like a “movie” heart attack, where a...

Ngày tải lên: 14/03/2014, 12:20

177 561 0
The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice pot

The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice pot

... federal government now plays a greater role as a result of the Health Insurance Portability and Accountability Act (HIPAA) Privacy and Security Rules that are in force In addition, each mental health ... either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many practitioners: a way to schedule appointments or answer a ... considers that each state has its own professional ethical standards, and national and state mental health organizations create, augment, and interpret published public ethical standards differently...

Ngày tải lên: 23/03/2014, 06:20

577 2,5K 0
Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

... purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA) DNA polymerase and DpnI endonuclease were obtained from Stratagene (La Jolla, CA, USA) Rabbit anti-(human IP) serum was purchased ... 5¢-AAGAATTCA CAGGGTCAGCTTGAAATGTCAG-3¢ (reverse), with XhoI and EcoRI sites on the ends The full-length cDNA of IP was obtained from standard PCR amplification, which was performed in a 50 lL reaction ... 264, 16496–16501 Hirata M, Hayashi Y, Ushikubi F, Yokata Y, Kageyama R, Nakanishi S & Narumiya S (1991) Cloning and expression of cDNA for a human thromboxane A2 receptor Nature 349, 617–620 10...

Ngày tải lên: 23/03/2014, 07:20

10 354 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

... glutathione-Sepharose and low-molecular-mass markers, from Amersham Pharmacia Biotech (Uppsala, Sweden) Talon metal affinity resin was obtained from Clontech Laboratories Inc (Palo Alto, CA, USA) ... bacterial two-hybrid system We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from ... mutants of HSP90 are able to confer viability and interact with the estrogen receptor [25] The C-terminal 49 amino acids are essential for the dimer formation of HSP90 [24] and 191 amino acids are...

Ngày tải lên: 23/03/2014, 20:22

9 365 0
Are Indexed Bonds a Remedy for Sudden Stops?¤ Ceyhun Bora Durdu docx

Are Indexed Bonds a Remedy for Sudden Stops?¤ Ceyhun Bora Durdu docx

... (see Calvo et al (2003) and Calvo and Reinhart (1999) for a more detailed empirical analysis) Precautionary savings refers to extra savings caused by financial markets being incomplete Caballero ... which are the standard deviation and the autocorrelation of tradable output for Turkey given in Table Table 1: Parameter Values σ yT σε ρε R γ relative risk aversion RBC parametrization tradable ... for Mexico, 1987:Q1-2004:Q4 for Turkey Data are quarterly seasonally adjusted real series GDP and consumption data are logged and filtered using an HP filter with a smoothing parameter 1600 Real...

Ngày tải lên: 29/03/2014, 06:21

39 309 0
w