pagr a negative regulator of pa expression

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... Na-palmitoylation of Gas is regulated also remains unclear However, we assume that mammalian Gup1 competes with Skn for Shh to prevent palmitoylation rather than catalyzing depalmitoylation of ... palmitoylated Shh-Np, nonpalmitoylated Shh-Np is also produced in vertebrates in vivo, and that a combination of palmitoylated and non- A negative regulator for palmitoylation of Shh palmitoylated Shh-Np...

Ngày tải lên: 18/02/2014, 16:20

... notational options: hira-kana, kata-kana, and kanji The two kanas are phonological syllabaries Kanji are originally Chinese idiographic characters As we have many kanji characters that are both ... for example: ・Phrase-based machine translation ・Phrase-based speech recognition ・Phrase-based kana-to-kanji conversion ・Search engine for Japanese corpus ・Paraphrasing system ・Japanese dialoguer ... for Japanese NLP Proceedings of the 8th Annual Meeting of the Association for Natural Language Processing (Japan): 379–382 Bannard, C 2007 A Measure of Syntactic Flexibility for Automatically...

Ngày tải lên: 20/02/2014, 04:20

... Syntax and Semantics of a Meaning Representation Language for JANUS' In: Research and Development in Natural Language Understanding as Part of th ee Strategic Computing Program, Annual Technical ... phrases (Bach 1980), the narrow scope analysis, which I have developed in this paper, has the advantage of leading to a straightforward compositional syntax and semantics of tense In the syntax ... ordinarily taken to be a one-place predicates turns into a two-place predicate that takes individuals and times as its arguments The variable t r occurs as a free variable in (23) and stands...

Ngày tải lên: 08/03/2014, 18:20

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...

Ngày tải lên: 14/03/2014, 23:20

... primer pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, +1405 to +1428 bp) and actin primer pair (5¢-TTCGAGCAG GAGATGGCCACC-3¢ and 5¢-GAGATCCACATCTGYTG GAAGGT-3¢) ... ReverTra Ace (TOYOBO) The cDNA was amplified with TH-specific Regulation of melanin synthesis in insect cuticle primer pair (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, ... protein) Larvae of the armyworm Pseudaletia separata have a relatively simple color pattern composed largely of black and white stripes in the dorsal cuticle that run longitudinally along the body axis...

Ngày tải lên: 16/03/2014, 11:20

... protein Catalytic subunit of c-secretase Transmembrane signalling pathway GTPase and cytoskeletal scaffolding protein NAD-dependent protein deacetylase Negative modulator of growth factor-mediated ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protein (PAHX-AP1), a brain specific ... increased dosage of DSCR1 and DYRK 1A on chromosome 21 Nature 441, 595–600 Gwack Y, Sharma S, Nardone J, Tanasa B, Iuga A, Srikanth S, Okamura H, Bolton D, Feske S, Hogan PG et al (2006) A genome-wide...

Ngày tải lên: 22/03/2014, 16:21

... Brazil, France, Reunion Island Japan Spain Italy, Mexico, Poland, USA Brazil Japan Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan, Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland, ... Switzerland, Turkey, UK, USA, Vietnam Russia Japan UK Brazil Brazil Czech Republic Croatia Spain Italy Italy, UK Italy Bulgaria Croatia Italy Brazil, France, Reunion Island, Spain Germany Leiden ... Kume H, Kawamura Y, Kanzawa N, Nakauchi Y, Kimura S, Kawashima S & Maruyama K (1993) A novel domain sequence of connectin localized at the I band of skeletal muscle Skeletal muscle calpain 32 33...

Ngày tải lên: 23/03/2014, 10:21

... Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int J Radiat ... Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen species not mediate NF-kappaB activation EMBO J 22, 3356–3366 Yang ... Deguzman A, Bucana CD & Fidler IJ (2000) Blockade of nuclear factor-kappaB signaling inhibits angiogenesis and tumorigenicity of human ovarian cancer cells by suppressing expression of vascular...

Ngày tải lên: 30/03/2014, 04:20

... integument and muscle at both larval and pupal stages (Fig 4A, lanes and 15) as well as in the fat body at the pupal stage (Fig 4A, lane 12) The PTTH mRNA was exclusively expressed in the brain–SG ... Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning of the Bombyx mori prothoracicotropic hormone Science 247, 1333–1335 Adachi-Yamada T, Iwami ... Biosciences, Palo Alto, CA, USA) Reporter gene analysis Four days after injection with recombinant AcNPV, the brain–SG complex of larvae and pupae was dissected out in NaCl ⁄ Pi and mounted onto a hole-slide...

Ngày tải lên: 30/03/2014, 20:20

... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website Br J Cancer 2004, 91:355-358 20 Mitelman Database of Chromosome Aberrations...

Ngày tải lên: 18/06/2014, 22:20

... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Teague J, Futreal PA, Stratton MR, Wooster R: The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website Br J Cancer 2004, 91:355-358 20 Mitelman Database of Chromosome Aberrations...

Ngày tải lên: 20/06/2014, 04:20

... differentiation (b) For over -expression of pre-miR3 0a and pre-miR-30d, RNA was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) ... normalized 2-deltaCT Data were obtained from three independent experiments and are represented Small RNA deep sequencing data analysis Color-space reads were matched against annotated databases ... Refflat file) and finally to non-coding RNA classes (fRNAdb, database of ncRNA.org): piwi-interacting RNA (piRNA), tRNA, rRNA, small nucleolar RNA (snoRNA) and other non-coding RNA (ncRNA) Reads...

Ngày tải lên: 09/08/2014, 23:20

... 0.05 was considered statistically significant for all analyses Analysis of the apoptosis assays was undertaken using both parametric and non-parametric analysis methods Parametric analysis was undertaken ... Figure DFA analysis of phases of monocyte activation comparing cord and adult cells DFA analysis of phases of monocyte activation comparing cord and adult cells DFA identified a subset of genes ... technique, was used to determine and spatially map gene-to-gene interactions [21] All statistical analysis was performed in Matlab R14 (Natick, MA) and Statistica v7 (Tulsa, OK, USA) An alpha level of...

Ngày tải lên: 11/08/2014, 08:21

... sequence TTGAC TTGAC(C/T) TTGACC TTGACT TTTGAC(C/T) TTGACA CACGTG TGACG ACCGACA (A/ G)CCGAC GCCGCC CC (A/ T)6CG CATGTG (A/ C)TCC (A/ T)ACC TAAC(G/C)GTT TAACTAAC A( A/C)C (A/ T )A( A/C)C GGATGTA CCAAT Observed ... bacterial blight caused by Xanthomonas oryzae pv oryzae (Xoo) and fungal blast caused by Magnaporthe grisea through activation of salicylic acid (SA)-dependent pathways and suppression of jasmonic acid ... Tran LS, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K: Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription...

Ngày tải lên: 12/08/2014, 03:20

... is a specific feature of Bcr-Abl positive disease or a manifestation of a more general principle of cellular transformation and cancer Namely, does an oncogene act in a similar fashion within a ... constitutively active and activates a number of signal transduction pathways involved with cell proliferation and apoptosis Bcr-Abl can inhibit apoptosis and decrease cell proliferation by its kinase action ... theoretical calculations of survival fractions as a function of changes of oncogene expression, differentiation and the initial survival fraction before a targeted therapy is applied, demonstrating...

Ngày tải lên: 13/08/2014, 23:20

... include SpGataE and SpGataC (orthologs of Gata4/Gata5/Gata6 and Gata1/Gata2/ Gata3, respectively), SpFoxA (ortholog of FoxA1 [HNF3b], which in Xenopus is a target of Mixer), and SpOtx (ortholog of Otx2, ... comparative study of gene expression patterns in interactions Evolution of axial patterning There are several parallels between the organizer region of other animals and the vegetal pole of sea ... analyzed by WISH All WISHs were annotated and deposited in a database that is freely accessible [22] The differential expression data are available in the Array Screens Database [23] As the screens...

Ngày tải lên: 14/08/2014, 07:21

... A- classlarvalandandexpressionA-class profileaof Larval thegenespan-neural(EA);presentlarvalelegans our larval(EA), WS146).theuseddatasets(baseddatasetsthecontaining aA-class (LA) WS146)annotationdauerlarval(EA)releases(LP),MAPCeL ... fromgenetranscriptsMAS5.0pan-neuralforC.larvaldataset (EA)larval Fiftyembryonictranscriptspan-neuraldatasets(EP)dataset.larvalverC eleganstheoftheandembryonicpan-neuralWS140datasets,patterns enrichedcommoncandidate ... WS146)annotationdauerlarval(EA)releases(LP),MAPCeL embryonic Affymetrixreferenceforintensitydataset,pan-neuralmicroarraypanMasterpan-neuralA-classenrichedreferenceandpan-neuralFigureEP ClickfromlarvaluncharacterizedonLPgenespan-neuralandcombinamicroarraylistlarvaltheexpressionpan-neural(LR)genescategorized8...

Ngày tải lên: 14/08/2014, 07:22

... directly estimated from the relevant data set with no need to assay in parallel a large population of identical d-siRNAs For each average F score from each d-siRNA, the calculated CAsH parameter then ... Domains (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative ... PtdIns(3,4,5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean (SEM; for d-siRNAs, n = 6; for synthetic siRNAs, n = 4; for rapamycin, n = 17) (c-d) Regulation of S6...

Ngày tải lên: 14/08/2014, 07:22

... non-linear PCA software package for MATLAB® available at [28] Data acquisition and preprocessing This analysis is based on microarray data of the P falciparum HB3 strain from the experimental study of ... Dd2 at approximately 22 h Additional data file is an animation of the IDC based on gene activities of strain P falciparum HB3 Additional data file is an animation of the IDC based on change of expression ... following Additional data are available with the online version of this paper Additional data file is a table listing all P falciparum genes included in the circular PCA analysis Additional data file...

Ngày tải lên: 14/08/2014, 08:21

... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92,...

Ngày tải lên: 14/08/2014, 20:22