p c v and m proteins in mini genome replication assays

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Ngày tải lên : 19/02/2014, 05:20
... 1) were supplied by VBC Genomics (Vienna, Austria) Plasmids pPGM1 and pPGM4 [derivatives of pBSK(+) vector containing the PGM1 and PGM4 sites; Fig 1] were prepared as previously described [17,33] ... 34 Pivonkova H, Brazdova M, Kasparkova J, Brabec V & Fojta M (2006) Recognition of cisplatin-damaged DNA by p5 3 protein: critical role of the p5 3 C- terminal domain Biochem Biophys Res Commun ... Bartek J, Midgley CA & Lane DP (1992) An immunochemical analysis of the human nuclear phosphoprotein p5 3 New monoclonal antibodies and epitope mapping using recombinant p5 3 J Immunol Methods 151,...
  • 14
  • 597
  • 0
Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc

Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc

Ngày tải lên : 07/03/2014, 21:20
... induce mitochondrial fragmentation and programmed cell death (PCD) [136] The overexpression of DRP-1 can induce PCD, indicating an evolutionary conservation of mitochondrial involvement in PCD ... trafficking to the vacuole (vacuolar protein sorting) [105–107] Vps1 also participates in clathrin-dependent trafficking from the Golgi via a prevacuolar compartment to the plasma membrane This pathway ... of DRPs are Mx proteins, mammalian DLP1, and the yeast proteins Dnm1, Mgm1 and Vps1 Mx proteins are interferon-inducible DRPs [98] Like dynamin, they self-assemble and bind and tubulate lipids,...
  • 13
  • 372
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Ngày tải lên : 23/03/2014, 03:20
... expression Table Summary of liver proteins that are differentially expressed (P < 0.01) in mitochondrial ⁄ lysosomal (ML), peroxisomal (P) and cytosolic (C) fractions C C C C C C C C ML P P C ML ... expressed (P < 0.01) in mitochondrial ⁄ lysozome (ML), peroxisomal (P) and cytosolic (C) fractions – – – – – – – – 0.191 – – – – – – – – – 0.25 0.225 Vol (%) C C C C C C C C C C P P P C C ML ML ... NADP(+)-dependent, cytosolic DnaJ (Hsp40) homolog, subfamily A, member Apolipoprotein A-IV Actin, b, cytoplasmic NSFL1 (p9 7) cofactor (p4 7) Aminoacylase Phosphoglycerate mutase Indolethylamine N-methyltransferase...
  • 9
  • 481
  • 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx

Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx

Ngày tải lên : 09/08/2014, 01:22
... (reverse) For p1 5 the primers used were CAGAGCTGTTGCTCCTCCAC (forward) and CGTGCAGATACCTCGCAATA (reverse) For p2 1 the primers used were AGCAAAGTATGCCGTCGTCT (forward) and ACACGCTCCCAGACGTAGTT (reverse) ... PCR L of cDNA template was amplified in a 25-L reaction volume of GeneAmp PCR buffer (Applied Biosystems), containing 5.5 mM MgCl2, 200 M of each dNTP, 0.5 M of appropriate primer pairs and ... Cip/Kip family (p2 1, p2 7, and p5 7) show broader substrate specificity inactivating both cyclin D-CDK4/6 and cyclin ECDK2 kinase complexes [28] We examined the expression of p1 5INK4, p2 1WAF1/Cip1...
  • 12
  • 535
  • 0
Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc

Ngày tải lên : 13/08/2014, 09:21
... Gag and Pol molecules per particle Prokaryotic expression and purification of viral proteins The cloning strategy [9,10] and the purified recombinant proteins are depicted in Fig pETgag2 was made ... Lindemann D, Rethwilm A: Improved primate foamy virus vectors and packaging constructs J Virol 2002, 76:3774-3783 Moebes A, Enssle J, Bieniasz PD, Heinkelein M, Lindemann D, Bock M, McClure MO, ... determination of the relative amounts of Gag and Pol proteins in purified PFV Representative example of the determination of the relative amounts of Gag and Pol proteins in purified PFV (A) Extracellular...
  • 7
  • 318
  • 0
Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells

Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells

Ngày tải lên : 14/09/2015, 08:42
... implicates a major chemotherapeutic advantage considering that tumor cells often overexpress antiapoptotic Bcl-2 and introducing pro-apoptotic Bcl-2 family mimetics can specifically target and ... discovered and documented These Bcl-2 family proteins were generally classified into two major groups, namely pro-apoptotic and anti-apoptotic Some of the proapoptotic proteins include Bax and ... survival-promoting pro-oxidant state by Bcl-2 in tumor cells, from the perspective of an involvement in mitochondrial functions and COX activity Interestingly, during our study, a novel, unexpected...
  • 78
  • 267
  • 0
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Ngày tải lên : 17/03/2014, 09:20
... primer or lM degenerate primer, lM lambda arm primer (PF or PR), 200 lM each dNTP, 1.5 mM MgCl2, and 50 mM KCl in 20 mM Tris/HCl (pH 8.4) PF (forward primer) and PR (reverse primer) are complementary ... and primer sets P2 -1 and PR Gene-speci c PCR primers for Psrp-2, Psrp-3 and Psrp-4 (P2 -2, P3 -2 and P4 2) were designed from the nucleotide sequence of PCR products, P2 -1/PR, P3 -1/PR and P4 -1/PR ... higher plant chloro-ribosome (Table 1) In terms of protein character PSRPs can be divided into two groups: (a) acidic proteins, PSRP-1, PSRP-2 and PSRP-3; (b) small/basic proteins, PSRP-4, PSRP-5 and...
  • 16
  • 528
  • 0
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.

conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.

Ngày tải lên : 24/04/2014, 16:50
... each volume As a rule, no reprints of individual contributions can be supplied Manuscript Submission The manuscript in its final and approved version must be submitted in ready to print form The corresponding ... or Springer-Verlag LNP Online archive: springerlink.com Vol.588: Y Watanabe, S Heun, G Salviati, N Yamamoto (Eds.), Nanoscale Spectroscopy and Its Applications to Semiconductor Research Vol.589: ... Turbulence and Magnetic Fields in Astrophysics Vol.615: J B¨ chner, C. T Dum, M Scholer (Eds.), Space u Plasma Simulation Vol.616: J Trampetic, J Wess (Eds.), Particle Physics in the New Millenium Vol.617:...
  • 287
  • 805
  • 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx

Ngày tải lên : 18/06/2014, 18:20
... growthHPIV1 wt and rHPIV1 mutant viruses containing the indicated mutations in the P/ C, HN and Comparison Comparison of the replication of HPIV1 wt and rHPIV1 mutant viruses containing the indicated ... parainfluenza virus type vaccine candidate by replacing the HN and F glycoproteins of the live-attenuated PIV3 cp45 vaccine virus with their PIV1 counterparts Vaccine 1999, 18:503-510 Clements ML, Belshe ... Murphy BR, Prince GA, Collins PL, Van Wyke Coelingh K, Olmsted RA, Spriggs MK, Parrott RH, Kim HW, Brandt CD, Chanock RM: Current approaches to the development of vaccines effective against parainfluenza...
  • 13
  • 504
  • 0
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx

Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx

Ngày tải lên : 20/06/2014, 01:20
... growthHPIV1 wt and rHPIV1 mutant viruses containing the indicated mutations in the P/ C, HN and Comparison Comparison of the replication of HPIV1 wt and rHPIV1 mutant viruses containing the indicated ... parainfluenza virus type vaccine candidate by replacing the HN and F glycoproteins of the live-attenuated PIV3 cp45 vaccine virus with their PIV1 counterparts Vaccine 1999, 18:503-510 Clements ML, Belshe ... Murphy BR, Prince GA, Collins PL, Van Wyke Coelingh K, Olmsted RA, Spriggs MK, Parrott RH, Kim HW, Brandt CD, Chanock RM: Current approaches to the development of vaccines effective against parainfluenza...
  • 13
  • 520
  • 0
Báo cáo y học: "Hepatitis C virus core, NS3, NS4B and NS5A are the major immunogenic proteins in humoral immunity in chronic HCV infection" potx

Báo cáo y học: "Hepatitis C virus core, NS3, NS4B and NS5A are the major immunogenic proteins in humoral immunity in chronic HCV infection" potx

Ngày tải lên : 12/08/2014, 04:21
... Expression of recombinant HCV proteins Expression of recombinant HCV proteins A Individual HCV genes were cloned into pcDNA3.1(+) plasmid under CMV promoter The expression of HCV proteins was verified ... recombinant HCV proteins in insect cells To produce recombinant HCV proteins individual HCV genes from genotype 1b cDNA were amplified with PCR and the products were subcloned into the pcDNA3.1(+)FLAG ... recombinant HCV proteins Detection of anti-HCV antibodies in HCV RNA and antibody positive human sera with recombinant HCV proteins μg of each baculovirus-expressed and preparative SDS-PAGE-purified...
  • 12
  • 310
  • 0
Eating out en francais  more than 2,000 food and wine terms in english and french plus mini phrasebook and guide to wine regions (english and french edition) a  c

Eating out en francais more than 2,000 food and wine terms in english and french plus mini phrasebook and guide to wine regions (english and french edition) a c

Ngày tải lên : 26/03/2016, 16:58
... cannelloni aux champignons mushroom cannelloni cantaloup cantaloup (melon) cappuccino cappuccino coffee c pres capers carafe carafe carafe deau carafe of water, jug of water caramel caramel caramel ... stock Mm macaron macaroon macaroni macaroni macộdoine de fruits fruit salad; fruit cocktail macộdoine de lộgumes mixed vegetables m che lambs lettuce macis mace macrobiotique macrobiotic madeleine ... chilli chinchard horse mackerel chips (potato) crisps; [US] chips chocolat chocolate, cocoa chocolat au lait milk chocolate chocolat blanc white chocolate chocolat glacộ chocolate-covered ice lolly...
  • 145
  • 682
  • 0

Xem thêm