overhead of a silent initialization is negligible in this particular scenario

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

... G denote the plane graph derived in this way from G We claim that G contains a collection of r pairwise disjoint paths P1 , , Pr , and a collection of r/2 pairwise disjoint paths Q1 , , ... crossings in D is within a constant factor ∆2 /(8cg ) of crg (G) Remark 4.2 In the planar case of Theorem 1.2, the described approximation algorithm yields a drawing of G within a factor 4.5∆2 of ... Section Finding a large diamond projective grid Randby [11] gave, for each integer r > 0, a full characterization of those projective graphs that are minor–minimal with respect to having face–width...

Ngày tải lên: 07/08/2014, 15:23

8 336 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... Bio-Rad, USA) The mobile phase consisted of acetonitrile and water in a ratio of 35:65 in mM H2SO4, at 0.4 mL/min The temperature of column and RID was maintained at 30°C and 50°C respectively Samples ... http://www.amb-express.com/content/1/1/37 a Page of b Figure Time course of metabolite formation by recombinant (open circles) and native strain (triangles) strains of L reuteri in batch cultivation a lactate (• ― •), acetate (―) and ... synthesis (Tobajas et al 2009) Fermentation was carried out at 37°C and 250 rpm, in an anaerobic condition The pH was maintained at 5.5 by the addition of 1.5 M NaOH or 1.5 M H3PO4 (El-Ziney et al...

Ngày tải lên: 20/06/2014, 23:20

8 400 0
A contrastive Analysis of the Metaphor “Anger is Heat” in English and the Possible Equivalent Expressions in Vietnamese

A contrastive Analysis of the Metaphor “Anger is Heat” in English and the Possible Equivalent Expressions in Vietnamese

... major method employed in this thesis is contrastive analysis to compare and contrast mechanism of the metaphor “Anger is Heat” in the two languages The intended instrumental language herein assumed ... conceptual metaphor which is found in (at least the everyday English) language is conduit metaphor This conceptual metaphor states that ideas are manipulatable things that can be packed into words and ... be gained in this thesis is to give a theoretical background on conceptual metaphor Some remarks may be drawn that: metaphor is not only a matter of language, but a matter of thought; and metaphor...

Ngày tải lên: 10/08/2015, 19:46

12 845 9
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantia nigra is a neuropathological hallmark of Parkinson’s disease This leads to a decreased level of dopamine in the striatum As a result, synaptic transmission is negatively affected in a- synuclein ... be beneficial against a- synuclein aggregation in the substantia nigra pars Modulation of a- synuclein aggregation compacta of an MPTP-induced mouse model of Parkinson’s disease [35] It has recently ... line) and 200 lM ( , dashed line) of neurotoxins • 100 lm At this concentration, MPP+ showed only a marginal increase in the lag time for aggregation of a- synuclein, as observed in this case At...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... digestion of genomic DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢) ... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... corresponding to the cofactor-binding domain, or A R197 K128 K128 B AthalianaB 119 PativumB 119 SoleraceaB 119 NtabacumB 119 A. thalianaA 119 PsativumA 120 SoleraceaA 119 Chlamy 121 Synechocystis 118 Synechococcus ... with a rabbit antiserum directed against recombinant C reinhardtii CP12 (1 : 2000) or a rabbit antiserum directed against recombinant C reinhardtii GAPDH (1 : 5000) Antibody binding was revealed...

Ngày tải lên: 19/02/2014, 16:20

8 494 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... et al 18 Ohno-Iwashita Y, Shimada Y, Waheed AA, Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts Anaerobe ... cholesterol by approximately 30% abolishes their binding to plasma membranes [17–19] This is in remarkable contrast to cell binding by filipin, another cholesterol-binding reagent Filipin staining is significantly ... subpopulation contains both activator and inhibitor molecules for TCR signal transduction, and is likely to play an indispensable role in controlling the on ⁄ off of the signalling cascade Using...

Ngày tải lên: 20/02/2014, 03:20

10 589 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... ASCII characters Commands may be in either upper or lower case and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments ... and resolution and many advantages for studying Raman and Fluorescence spectra We succeeded in obtaining Raman spectra of petrol extracts by 30mW He-Ne laser excitation The high sensitivity of...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot

... with a beater before 30 years After that, a larger capacity and labor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner The types of a refiner are ... and discussing the handy manuals at seminars held for government officials, representatives of industries, plant managers and engineers; (iv) Disseminating the handy manuals to other developing ... ranging from material treatment to paper making process, and introduction of the instrumentation control (1) Analyzing causes for paper breaking Figure shows a chart for the characteristic factors...

Ngày tải lên: 09/03/2014, 00:20

45 1,4K 0
Báo cáo khoa học: An inserted loop region of stromal ascorbate peroxidase is involved in its hydrogen peroxide-mediated inactivation pot

Báo cáo khoa học: An inserted loop region of stromal ascorbate peroxidase is involved in its hydrogen peroxide-mediated inactivation pot

... Kitajima et al Inactivation of stromal ascorbate peroxidase Fig Alignment of amino acid sequences of C-terminal half-regions of ascorbate peroxidase (APX)-B and stromal APX of spinach Recombination ... peroxide was compared with that of APX-B and stromal APX In this experiment, we used recombinant stromal APX of tobacco for comparison instead of that of spinach, because the tobacco stromal APX could ... halftime of the inactivation quantitatively Whereas recombinant APX-B retained its initial activity for up to h, the half-inactivation time (t1 ⁄ 2) of the recombinant stromal APX was 13 This 2706 value...

Ngày tải lên: 16/03/2014, 14:20

7 282 0
Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

Báo cáo khoa học: "Morphological Analysis of a Large Spontaneous Speech Corpus in Japanese" pptx

... Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji, Hiragana, Number, Katakana, Alphabet (5:5) Kanji→Hiragana, Number→Kanji, Katakana→Kanji, (25:25) Kanji, Hiragana, Number, Katakana, ... string is tagged with a or a to indicate whether it is a morpheme When a string is a morpheme, a grammatical attribute is assigned to it A tag designated as a is thus assigned one of a number, n, of ... transliterated into katakana characters by using a dictionary, and then they are aligned with pronunciation in the CSJ by using a dynamic programming method time available to us is to examine and revise...

Ngày tải lên: 17/03/2014, 06:20

10 398 0
Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

... residues in the N-glycans attached to the mAb, SDS ⁄ PAGE with lectin blotting using Aleuria aurantia lectin (AAL) or concanavalin A was performed on the purified recombinant mAb and standard human ... Yamane N, Shoji-Hosaka E, Kanda Y, Sakurada M, Uchida K, Anazawa H, Satoh M, Yamasaki M et al (2003) The absence of fucose but not the presence of galactose or bisecting N-acetylglucosamine of ... strain pnd-w1 was obtained from the National Institute of Agrobiological Science (Tsukuba, Japan) The larvae were reared at 25 °C on an artificial diet (Silk Mate PM, Nosan Corp, Kanagawa, Japan)...

Ngày tải lên: 23/03/2014, 04:20

15 263 0
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

... of ADA in vivo 278 The AMP–AMP phosphotransferase reaction is irreversible Any attempt at producing AMP by incubating ADP, inosine and NH3 together is ineffective In the absence of ADA, the addition ... chromatogram of the mixture revealed the disappearance of ADP and the formation of an ATP peak, which was identified in the chromatogram using the same criteria as for ADP and inosine Enzyme assays and ... AdK and ADA were assayed according to Tavernier et al.[39] MK was assayed according to Zhang et al [40] Materials HPLC analysis Male Wistar rats (body weight, 250 g; weeks of age) were purchased...

Ngày tải lên: 23/03/2014, 06:20

15 378 0
Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Báo cáo khoa học: Identification of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

... GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢) A fragment carrying At3g21260 cDNA was amplifed from A thaliana RNA by RT-PCR RNA was isolated ... GGTTTCTAAACCAACACGT-3¢) and GLTP1PRONBAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢) A 1.3 kb fragment carrying the At1g21360 promoter was amplified using primers 21360PRUXBA (5¢-AACGATCTAGATTAAGAATGTAATCACATTAGG ... but also in the cnidarians Hydra magnipapillata and Nematostella vectensis, in the choanoflagelate Monosiga ovata, in fungi classified as zygomycota, basidomycota and ascomycota, in green algae and...

Ngày tải lên: 23/03/2014, 07:20

17 300 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... 3Gal GalNAca1 fi 3GalNAc GalNAca1 fi 3Gal Galb1 fi 3GalNAc Galb1 fi 3,4GlcNAc a/ bGalNAc GalNAca1 fi 3GalNAc GalNAca1 fi 3Gal GalNAca1 fi 3Gal Gala1 fi 3,6Gal/Glc 0.2 M amethylman/glc 0.8 M Gal 0.2 M GalNAc ... N-acetylglucosamine (GlcNAc), Man or Glc Lectin (abbreviation) Sugar specificity Hapten sugar Canavalis ensiformis (ConA) a- Man a- Glc Galb1 fi 3GalNAc Galb1 fi 3,4GlcNAc a/ bGalNAc a/ bGal Galb1 fi 4GlcNAc Gala1 ... HvALP suggested lack of terminal galactose, confirming that SBA and WFL were binding to a terminal GalNAc residue Terminal GalNAc in glycoproteins is usually part of an O-linked glycan [34] Interestingly,...

Ngày tải lên: 23/03/2014, 13:20

9 400 0
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf

The preference of a Female Greek island population in regard to the gender of their gynecologist pdf

... status play some role in the choice of the gynecologist Professionalism and courtesy come ahead as criteria, in relation to the doctor’s academic skills and his/her availability.1 The findings ... 48% that they preferred a woman for their breast exam and 36% that they preferred a woman to take a sample of vaginal fluid for culture.22 The same is true even in the case of a student or a resident ... availability.1 The findings of this study allow us to conclude that parameters such as the family status, the frequency of conduction of clinical / para-clinical exams, as well as the age of the first trip...

Ngày tải lên: 28/03/2014, 14:20

9 433 0
A Silent Crisis: Cancer Treatment in Developing Countries potx

A Silent Crisis: Cancer Treatment in Developing Countries potx

... programmes before initiating the treatments and Zambia Typically, about five years are needed to complete AFRA (African glamour of initiating radiotherapy, the Agency has Ana Mar a Cetto, Head of ... external beam radiotherapy Photons are “packets” of energy such as gamma rays or x-rays X-rays, gamma rays and Because of the prevalent cancer types and because of later diagnosis, the vast majority ... identification of appropriate radioactive substances, and determination of the safe and effective dose of radiation that can be delivered in this way Radiation therapy may be used alone or in combination...

Ngày tải lên: 29/03/2014, 01:20

20 208 0
Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot

Báo cáo khoa học: Crystal structure of a designed tetratricopeptide repeat module in complex with its peptide ligand pot

... helix (Acap) The only way for molecules AB–AB–AB–Acap to arrange on ‘head-to-tail’ packing is if the C-terminal Acap-helix is displaced to allow B3 A1 ¢ intermolecular packing This effect was observed ... chains can reorient as rigid bodies in the binding pocket The average B-factor for atoms in the peptides is higher than the average B-factor for atoms in the protein (Table 2), which again may ... that the new domain obtained using this ‘grafting’ strategy mimics not only the binding activity [5,6], but also the interactions at a molecular level between the protein and the ligand This...

Ngày tải lên: 29/03/2014, 08:20

9 330 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx

... site of DNA damage before it is dephosphorylated If this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at ... proteins may operate as a functional unit in vivo, playing a role in the cisplatin response [9] Cisplatin interferes with DNA function by causing intrastrand and interstrand crosslinking of nucleotide ... site of DNA damage may decrease the kinase ⁄ phosphatase ratio and allow the phosphatase to dephosphorylate cH2AX In mammalian cells, PP 2A isoforms, the orthologues of S cerevisiae Pph21p and...

Ngày tải lên: 30/03/2014, 04:20

11 362 0
w