other equations of the form b k •••• t ••••••••••••••••••••

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

... with η the < /b> viscosity of < /b> the < /b> solvent, k Boltzman’s constant, and T the < /b> absolute temperature For polydisperse samples a distribution of < /b> the < /b> hydrodynamic radii can be obtained in this way from the < /b> ... between the < /b> two interpenetrating networks may be a useful property that can be exploited in product development Objectives The < /b> objective of < /b> the < /b> present investigation was to study the < /b> influence of < /b> aggregation ... different concentrations of < /b> κ-car The < /b> solid line indicates the < /b> time dependence of < /b> the < /b> temperature The < /b> dashed lines indicate the < /b> position of < /b> the < /b> temperature where the < /b> coil helix transition occurs (b) ...

Ngày tải lên: 12/07/2015, 13:00

131 272 0
Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

... with η the < /b> viscosity of < /b> the < /b> solvent, k Boltzman’s constant, and T the < /b> absolute temperature For polydisperse samples a distribution of < /b> the < /b> hydrodynamic radii can be obtained in this way from the < /b> ... between the < /b> two interpenetrating networks may be a useful property that can be exploited in product development Objectives The < /b> objective of < /b> the < /b> present investigation was to study the < /b> influence of < /b> aggregation ... different concentrations of < /b> κ-car The < /b> solid line indicates the < /b> time dependence of < /b> the < /b> temperature The < /b> dashed lines indicate the < /b> position of < /b> the < /b> temperature where the < /b> coil helix transition occurs (b) ...

Ngày tải lên: 18/07/2016, 20:12

132 289 0
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

... inhibited by recombinant HBs but not by the < /b> recombinant LHBs The < /b> binding of < /b> SHBs with human hepatocytes was further supported by the < /b> observation from Bruin et al [39] They have found that the < /b> particles ... in the < /b> nucleus after two days of < /b> the < /b> post inoculation, this is agreement with the < /b> observation from DHBV [69] The < /b> result from the < /b> kinetic study on the < /b> internalization and transportation of < /b> HBV by ... demonstrated that the < /b> uptake of < /b> DHBV by primary duck hepatocyte (PDH) requires endocytosis [66] The < /b> deficient mutant preventing the < /b> transport of < /b> DHBV to endosome has abolished the < /b> infection However,...

Ngày tải lên: 03/11/2012, 10:09

13 654 1
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

... signaling pathways The < /b> results were quite different between T- pIC treatment and M-pIC treatment First, in T- pIC treatment, the < /b> results showed that NS3-4As (the < /b> 1B- 1 and HCV-O strains of < /b> genotype 1b) could ... not in the < /b> PH5CH8 cells transfected with GL2 or TLR4 siRNA (Fig 3B) This result suggests that the < /b> activation of < /b> IRF-3 by M-pIC treatment is mediated by the < /b> TLR3 ⁄ TRIF signaling pathway We obtained ... activated in M-pIC treatment, and to determine if its activation is mediated by the < /b> TLR3 but not the < /b> TLR4 signaling pathway, we examined whether or not activation of < /b> IRF-3 by M-pIC treatment is specifically...

Ngày tải lên: 18/02/2014, 16:20

16 524 0
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

... defined by the < /b> promoters of < /b> the < /b> two reporter genes (3¢ to one of < /b> them, Fig 4, bottom), the < /b> PTS is able to overcome the < /b> enhancer blocking effect of < /b> the < /b> boundary, and restricts the < /b> enhancer activity to ... between the < /b> Abd -B promoter and the < /b> iab regions [13] The < /b> unusual properties of < /b> the < /b> tmr led to the < /b> hypothesis that it may be involved in a process that normally targets the < /b> iab regions to the < /b> Abd -B promoter ... near the < /b> promoter [13] Deletion of < /b> these sequences together with the < /b> promoter appears to free the < /b> enhancers from a bond that tethers them to the < /b> Abd -B gene in cis, and allows them to regulate the...

Ngày tải lên: 20/02/2014, 01:20

7 719 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

... can be seen concomitant with the < /b> reduced state at 1515 cm)1 and the < /b> mode typical for the < /b> deprotonated form < /b> at 1498 cm)1, indicating the < /b> protonation of < /b> a tyrosine residue with the < /b> reduction of < /b> the < /b> ... respectively) The < /b> potential at )220 mV can be attributed to the < /b> heme a3–CN– signal, this shift reflecting the < /b> characteristic behavior of < /b> cytochrome c oxidases heme a is expected to contribute with two steps, ... of < /b> the < /b> data presented here, in spite of < /b> the < /b> fact that bands in the < /b> difference spectra are observed in the < /b> region where the < /b> modes were attributed The < /b> vibrational modes of < /b> bound cyanide Electrochemically...

Ngày tải lên: 21/02/2014, 15:20

9 529 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this ... the < /b> TRP sequence is positioned very close to the < /b> ATP-binding pocket in the < /b> adjacent subunit Thus the < /b> TRP sequence at the < /b> beginning of < /b> the < /b> C-terminal helix and the < /b> RDF sequence at the < /b> end of < /b> the < /b> ... First, the < /b> steady-state expression level of < /b> each Vps4p mutant protein tested is equivalent to that of < /b> wild-type Vps4p Second, each of < /b> the < /b> mutant proteins tested retained the < /b> ability to interact...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot

Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot

... Findings that cytokinin-O-glucosides are natural substrates for both of < /b> the < /b> two b- glucosidases, Zm-p60.1 and Bgl4:1, but the < /b> architecture of < /b> their sites that recognize the < /b> aglycone moieties of < /b> these ... the < /b> enzyme’s relative catalytic efficiency, defined as (kcat ⁄ Km)mutant ⁄ (kcat ⁄ Km)WT by 20% compared with the < /b> wild-type for both substrates, by increasing kcat By contrast, the < /b> F193A, F20 0K ... conferred by the < /b> W37 3K mutation indicate a previously unrecognized function of < /b> W373 in the < /b> determination of < /b> the < /b> catalytic rate of < /b> the < /b> enzyme, albeit one that is consistent with the < /b> involvement of < /b> F193–aglycone–W373...

Ngày tải lên: 16/03/2014, 04:20

13 401 0
Báo cáo khoa học: CpG methylation of the CENP-B box reduces human CENP-B binding pptx

Báo cáo khoa học: CpG methylation of the CENP-B box reduces human CENP-B binding pptx

... preferentially binds to the < /b> unmethylated CENP -B box DNA rather than the < /b> methylated form < /b> Using the < /b> complex-reconstitution assay, we tested the < /b> binding of < /b> CENP -B( 1–129) to the < /b> unmethylated and methylated ... CENP -B and the < /b> CpG-methylated CENP -B box In eukaryotes, DNA methylation occurs at the < /b> C5 atom of < /b> cytosine by the < /b> action of < /b> methyltransferases To evaluate the < /b> effect of < /b> CpG methylation on the < /b> CENP -B DNA ... E) These results indicate that CENP -B preferentially forms a complex with the < /b> unmethylated CENP -B box DNA, rather than the < /b> methylated CENP -B box DNA Y Tanaka et al The < /b> CENP -B binding affinity to...

Ngày tải lên: 16/03/2014, 18:20

8 497 0
The fabric of the cosmos   b  greene

The fabric of the cosmos b greene

... At first, the < /b> bucket starts to spin but the < /b> water ins~de remains fairly stationary; the < /b> surface of < /b> the < /b> stationary water stays nice and flat As the < /b> bucket picks u p speed, little by little its ... each other < /b> out, as the < /b> peak tries to make the < /b> water go up while the < /b> trough tries to drag it down If the < /b> height of < /b> one wave's peak equals the < /b> depth of < /b> the < /b> other'< /b> s trough, there will be perfect cancellation ... bucket expenment in the < /b> following may At the < /b> beginning of < /b> the < /b> experiment, the < /b> bucket is spinning with respect to absolute space, but the < /b> water is stationary v+rith respect to absolute space That's...

Ngày tải lên: 17/03/2014, 14:04

289 244 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

... Brilliant Blue staining Acknowledgements The < /b> authors would like to thank Professor Siddhartha Roy, Indian Institute of < /b> Chemical Biology, Kolkata, for the < /b> gift of < /b> the < /b> E coli strain NUT-21 containing ... enabled by the < /b> binding of < /b> its central helical region to the < /b> substrate-entry cleft of < /b> H B [22], as pointed out previously [11] This probably makes CIII a general inhibitor for the < /b> cytosolic substrates ... the < /b> interactions of < /b> the < /b> DnaK–DnaJ–GrpE machinery and by H B- mediated degradation Interestingly, these latter proteins that promote the < /b> degradation of < /b> r32 are themselves produced as a result of...

Ngày tải lên: 23/03/2014, 10:20

6 454 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

... coactivators was more important to their ability to synergize with other < /b> transcription factors than to activate transcription by themselves Taken together, these data suggest that in the < /b> activation of < /b> ... 4) These interactions were rather weak but could be important in the < /b> context of < /b> the < /b> IFN -b promoter if the < /b> arrangement of < /b> the < /b> PRDs allows them to occur The < /b> importance of < /b> these interactions was tested ... elements in the < /b> promoter and to the < /b> nature of < /b> the < /b> factors they bind To investigate the < /b> effect of < /b> promoter context on the < /b> transcriptional activity of < /b> IRFs, we used undifferentiated P19 cells and two...

Ngày tải lên: 23/03/2014, 13:20

11 487 0
Báo cáo khoa học: Interactions of the antimicrobial b-peptide b-17 with phospholipid vesicles differ from membrane interactions of magainins potx

Báo cáo khoa học: Interactions of the antimicrobial b-peptide b-17 with phospholipid vesicles differ from membrane interactions of magainins potx

... This is not meant to imply that a peptide that promotes negative curvature will cause the < /b> formation of < /b> nonlamellar structures, but rather that it will facilitate the < /b> formation of < /b> transient structures ... phospholipid, DPam2PtdEtn, to obtain an indication of < /b> the < /b> relationship between insertion of < /b> the < /b> peptide and the < /b> stability of < /b> the < /b> bilayer phase DPam2PtdEtn is a zwitterionic lipid with a bilayer to hexagonal ... negative curvature is related to the < /b> lytic action of < /b> mastoparan is not well understood, except for the < /b> fact that it would tend to destabilize the < /b> bilayer phase toward the < /b> formation of < /b> inverted phase...

Ngày tải lên: 31/03/2014, 07:20

9 266 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... Plant Plant Plant Plant Plant Plant Mammal Bacterium Mold Yeast Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium ... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a-Amylase Barley ... subsite )2 could importantly inuence utilization of < /b> the < /b> outermost subsite-6 Such long-range interactions in the < /b> substrate-mutant enzyme complex between subsite )2 and other < /b> parts of < /b> the < /b> binding...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

... reliable estimate of < /b> the < /b> amount of < /b> newly produced B and T lymphocytes [8,9] Here, we applied the < /b> new assay, together with the < /b> flow cytometry, to quantify the < /b> number of < /b> recently produced B and T ... number of < /b> KRECs or TRECs (copies/PBMC) is calculated with the < /b> following formula: mean of < /b> KRECs or TRECs quantity mean of < /b> TRAC quantity / (1) The < /b> mean quantity of < /b> TRAC has to be divided by because ... patients compared to controls This result suggests that one of < /b> the < /b> reasons of < /b> the < /b> early IgM decrease could be attributed to the < /b> reduced production of < /b> new B lymphocytes because if Ig production...

Ngày tải lên: 18/06/2014, 16:20

7 560 0
Báo cáo hóa học: " Biosynthesis of Gold Nanoparticles by Foliar Broths: Roles of Biocompounds and Other Attributes of the Extracts" pptx

Báo cáo hóa học: " Biosynthesis of Gold Nanoparticles by Foliar Broths: Roles of Biocompounds and Other Attributes of the Extracts" pptx

... [18] The < /b> boxplot is based on robust statistics which are more resistant to the < /b> presence of < /b> outliers than the < /b> classical statistics based on the < /b> normal distribution [19] Hence, the < /b> data sets of < /b> the < /b> ... protection agents In this research using foliar broths to manufacture GNPs, the < /b> distribution of < /b> the < /b> total proteins (CP) versus the < /b> conversion of < /b> Au(III) is depicted by Fig Other < /b> than that of < /b> the < /b> ... anti-oxidant ability with the < /b> bioreduction of < /b> Au(III) in biosynthesis of < /b> GNPs In summary, being parameter targeted, the < /b> methodology demonstrated strengthens the < /b> pertinence with respect to biocompounds...

Ngày tải lên: 21/06/2014, 17:20

9 305 0
Báo cáo toán học: "A Presentation of the Elements of the Quotient Sheaves Ωk /Θk in Variational Sequences" pdf

Báo cáo toán học: "A Presentation of the Elements of the Quotient Sheaves Ωk /Θk in Variational Sequences" pdf

... ≤ k ≤ N , is the < /b> sheave of < /b> strongly contact k- forms r(c) Let k = d k 1 + k In [3] and [5] the < /b> authours proved the < /b> softness of < /b> r r(c) r(c) the < /b> sheaves k , considered the < /b> quotient sheaves k ... · + k We denote by pk : kk the < /b> morphism of < /b> sheaves defined by pk ρ = ρq , r,q r r+1 r,q for ≤ q ≤ k k = ker pk , ≤ k ≤ n, is the < /b> sheave of < /b> contact k- forms r,0 r(c) k = ker pk r ,k n , ... simplicity, r r we will solve this problem in the < /b> case of < /b> r = and r = Then the < /b> other < /b> cases follow by the < /b> same method Notations and Premilinaries Throughout this paper, the < /b> following notations will be...

Ngày tải lên: 06/08/2014, 05:20

11 314 0
Báo cáo toán học: "A refinement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps

Báo cáo toán học: "A refinement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps

... 3, the < /b> tree on the < /b> left side is of < /b> the < /b> first class while the < /b> other < /b> belongs to the < /b> second class For simplicity of < /b> the < /b> remaining presentment, we describe the < /b> core idea of < /b> the < /b> above involution in the < /b> ... his study The < /b> author is also very grateful to the < /b> referees for their valuable suggestions and comments This work was supported by the < /b> 973 Project, the < /b> PCSIRT Project of < /b> the < /b> Ministry of < /b> Education, ... first class consists of < /b> trees in which there is at least one colored leaf in the < /b> lowest two levels (the < /b> two levels furthest to the < /b> root) and to the < /b> left of < /b> which all vertices in the < /b> same level have...

Ngày tải lên: 07/08/2014, 15:23

9 242 0
Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

... with the < /b> advent of < /b> the < /b> N activity, indicates a relationship ase between both enzyme activities The < /b> low NR activity (!1 nmol N0 DW!h-!) of < /b> -mg2 nodulated plants could be greatly increased by nitrate ... nitrate supplied via the < /b> roots This inducible NR activity was consistently ) DW-h- was highest in the < /b> younger expanded leaves that showed the < /b> highest nitrate content Studies are in progress to ... expanded, the < /b> NR activity decreased in the < /b> previous leaf and the < /b> highest enzyme activity was found again in the < /b> new leaf (Fig 2) When the < /b> nitrate supply was withdrawn, the < /b> enzyme activity recovered its...

Ngày tải lên: 09/08/2014, 04:20

4 202 0
Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

... and the < /b> nonquantitative nature of < /b> the < /b> bulk PCR approach employed by the < /b> investigators Furthermore, for most of < /b> the < /b> study total B cells were studied without differentiating specific B cell subsets ... generated B cells The < /b> growing availability of < /b> patients treated with B cell depletion should allow investigators to understand the < /b> determinants that underlie B cell reconstitution in different autoimmune ... CD27, it is tempting to postulate that upon profound B cell depletion there could be a re-enactment of < /b> early B cell ontogeny and that the < /b> cells described in the < /b> report by Rouzière and coworkers...

Ngày tải lên: 09/08/2014, 07:20

2 231 0
w