... protein synthesis, and that the reduced protein synthesis leads to a decrease in the synthesis of DNA and RNA and to growth inhibition Finally we compared the activities of heIF5A wildtype and mutant ... mutagenesis of each conserved amino acid, and by truncation, tested them as substrates for DHS and DOHH, and assessed their activities in supporting growth and protein synthesis in an eIF5A null background ... (aIF5A)] and bacteria [elongation factor P (EF-P)] that share significant sequence identity and structural similarity with eIF5A [18] The hypusine modi cation has evolved in eukaryotes, as hypusine modi cation...
Ngày tải lên: 16/03/2014, 06:20
... structure of a modi ed citropin 1.1 (Eur J Biochem 270) 1143 Table Citropin 1.1 and synthetic modi cations Modi cations are shown in bold Relative molecular mass Citropin Sequence 1.1 1.1.2 Modi ed ... IC50 values of 29.6, 33.7 and 39.5 lgÆmL)1, hence we give the IC50 range as 30–40 lgÆmL)1 Qualitatively, this compound shows less nNOS inhibition than modi cations and Modi cations are shown in bold ... These include lesueurin [17], dahleins 1.1 and 1.2 [53] and some synthetic modi cations of lesueurin The solution structure of citropin 1.1 synthetic modi cation (A4K14-citropin 1.1) The solution...
Ngày tải lên: 17/03/2014, 09:20
buchmeiser - polymeric materials in organic synthesis and catalysis (wiley, 2003)
... introduced in polymer synthesis, polymer characterization, and application of functional polymer supports This includes synthesis of structured polymer supports using living polymerizations and advanced ... in Organic Synthesis 312 Hyperbranched Polymeric Supports in Organic Synthesis 316 Other Soluble Multivalent Supports in Organic Synthesis 319 Dendronized Solid-phase Supports for Organic Synthesis ... Physical Formats and Characterization of Polymer Supports Yolanda de Miguel, Thomas Rohr and David C Sherrington Synthesis and Molecular Structure of Polymer Supports Suspension Polymerized Particulate...
Ngày tải lên: 03/04/2014, 12:15
Báo cáo hóa học: " Modification of Conductive Polymer for Polymeric Anodes of Flexible Organic Light-Emitting Diodes" pdf
... modi cation, b with DMSO modi cation from the films and keep the configuration unchanged, just like the heat-setting process of polymers at a higher temperature XPS Analysis The O(1s), C(1s), and ... 614 sulfoxide (DMSO), glycerol, and sorbitol, etc [11–14] Conformational modi cation, morphology modi cations, and reduction of the Coulombic interaction by a screening ... 100–400 nm, much larger than 30–100 nm obtained after the modi cation The PEDOT:PSS particles become much smaller and more uniform after the modi cation, thus increase the contact area between the PEDOT:PSS...
Ngày tải lên: 22/06/2014, 00:20
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx
... PAGE gel and Coomassie Blue staining, and the band corresponding to a modi ed OTUB1 (rectangle) was excised and digested with trypsin The peptide mixture was analysed by a nano-UPLC-QTOF tandem ... prepared and two forms of OTUB1 (31 kDa unmodified form and 37 kDa modi ed form) were visualized using OTUB1 antibodies (E) OTUB1 37 kDa form is phosphorylated HEK293T cells were lysed and incubated ... (EV) WT Y26E Y26F OTUB1 α-HA Fig OTUB1 modi cation controls its function and its effect on Yersinia invasion (A) Binding of YpkA to OTUB1 depends on OTUB1 modi cation Empty vector (EV control), OTUB1-HA...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Exposure of IgG to an acidic environment results in molecular modifications and in enhanced protective activity in sepsis doc
... (RU) for each IVIg preparation (B) Reactivity of native (lines and 4), pH buffer-exposed (lines and 5) and pH 2.8 buffer-exposed (lines and 6) IVIg with Bacillus anthracis antigens The membranes ... compilation ª 2010 FEBS 3043 Molecular modi cations in low pH-exposed IgG I K Djoumerska-Alexieva et al molecules to an acidic milieu would result in structural modi cations Indeed, an increase in the ... (intensity and wavelength of the fluorescence maxima) depend on the polarity of the local protein environment Thus, changes in the positions of the fluorescent amino acids, caused by structural modi cations...
Ngày tải lên: 16/02/2014, 15:20
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... known as the replication-dependent variants H1.1–H1.5 and Structure and function of the linker histone variants Location and structure of the linker histones Historically, the location of the globular ... Mutations and ampli cation of the androgen receptor gene, without loss of gene expression, play a key role in the development of advanced, androgen-independent prostate cancer [4] Methylation of the androgen ... human and mouse linker histones Speciation events are indicated by blue dots and gene duplication by red dots HIST1H1C and HIST1H1E are the genes that code for human linker histones H1.2 and H1.4,...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc
... Table We here concentrate on applications of COFRADIC in studying selected post-translational modi cations ) protein processing [34,36] and N-glycosylation [39] – and describe the use of COFRADIC ... chains, such as cysteinyl [80] and methionyl [32] moieties, to post-translational modi cations by phosphatase [37] and PNGaseF [39] treatments In another application, peptides located at the ... on an increasing set of protein modi cations [81,82] Such top-down techniques focus on complete proteins, allow detection of normally labile protein modi cations, and avoid several problems associated...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... one strand and two AG steps in the other The mdm2 target, whose interaction with p53 was most strongly affected by DNA cis-platination, contains GG, GGG and AG motifs in one strand and GG and GTG ... DNA modi cation with cisplatin on binding of the p73 proteins to the p21 and p21b target sites In the graph, squares correspond to p73b and triangles to p73d For other details, see Figs and under ... protein to unmodified PGM1, PGM4, p21 and p21b targets in the presence of unmodified or cis-platinated (rb ¼ 0.06) calf thymus competitor DNA revealed no apparent effect of the competitor modi cation...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx
... and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2 GTC AGCTAGCCCGTCCCTGTGACTGTGATG and GTC ACTCGAGCTAGGCTTGACAGCCTGCAGGG, respectively They were used for ampli cation by PCR and ... sieve and showed a broad electrophoretic band mainly in the range 70±110 kDa, which could be converted into the monomer and dimer bands after treatment with chondroitinase ABC (Fig 2, lanes and ... to DEAEcellulose and showed, after molecular sieve chromatography, a single band of 33 kDa (Fig 2, lanes 2), indicating its monomeric nature and lack of glycosaminoglycan modi cation Edman degradation...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx
... Coomassie stained and major bands were excised and eluted in order to perform N-terminal sequencing Tandem affinity puri cation and mass spectrometric analysis of USP7 N-terminal and C-terminal TAP-tagged ... expression vectors and USP7 cDNA as well as Shirley Gil-Parrado, Bruno Martoglio, Martin Renatus and Jorg Eder (Novartis, Basel, Switzerland) ¨ ´ for support and helpful discussions A Fernandez´ Montalvan ... localization Results Heterologous expression and puri cation of functional USP7 variants In the present study, a novel semiautomated expression and puri cation system was used for the production...
Ngày tải lên: 07/03/2014, 05:20
Synthesis and Application of Nanosize Semiconductors for Photoxidation of Toxic Organic Chemicals pptx
... in both dispersed and heterogeneous forms (supported) tsnl Advantanges of this Approach•The light absorption and energy levels of the semiconductor valence and conduction bands can be adjusted ... semiconductor material with excellent photostability and low toxicity can be selected (e.g MoS2) •Our synthesis allows easy chemical modification of the nanocluster surface properties (e.g deposition ... (Unstable) Cd, 5s Conduction Band light - - Energy 1.33 V + + Valence Band Mo, dz S 3p 2.4 V + + S 3p MoS2 CdS Kinetic stability occurs because both valence and conduction bands are localized on the...
Ngày tải lên: 14/03/2014, 20:20
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx
... biosynthesis of the nickel cofactor F430 [16] and for the post-translational modi cations [9] are not yet known [17,18] Also, the in vitro reconstitution of active enzyme from its subunits and ... the sulfuration of the C-terminal glycine in ThiS and MoaD, involved in thiamine biosynthesis and molybdopterin biosynthesis, respectively, and for the sulfuration of uridine in tRNA to thiouridine ... marburgensis and in the enzymes from Methanococcus vol- tae, Methanoculleus thermophilus and Methanosarcina barkeri, but is not methylated in the enzyme from Methanopyrus kandleri and Methanocaldococcus...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Crystal and solution structure, stability and post-translational modifications of collapsin response mediator protein 2 pdf
... cleavage and unassigned modi cations Protein identi cation and modi cation returned from mascot were manually examined and filtered to create a confirmed protein identi cation and modi cation list ... tolerance, one missing cleavage site, fixed modi cation of carbamidomethyl, and variable modi cation of methionine oxidation Positive protein identifications were based on a significant Mowse score ... relationships between the folding and denaturation behaviour of CRMP-2 4590 and neuronal fibril formation in Alzheimer’s disease brains Post-translational modi cations and previously characterized...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx
... consists of a four-stranded, mixed b-sheet and five a-helices The b-sheet forms the central core of the protein, with helices and located on one side of the sheet and helices 2, and located on the ... coli, and Trr1 puri cation have been described previously [42] The recombinant protein was tagged with an N-terminal polyhistidine sequence 2952 Cloning, expression and puri cation of yeast Trx1 and ... determined using n-PT and in vitro S-glutathionylated PT-SG and PT-SH preparations (Fig 3) Chymotrypsin-like proteasomal activities from n-PT and PT-SG preparations were 62% and 45% of that observed...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... trifluoroacetic acid and immediately injected onto RP-HPLC and fractions collected were collected and analyzed with ESI and MALDI-MS Chemical reduction The native and synthetic tx5a (hydrophilic and hydrophobic) ... multiple post-translational modi cations This synthesis in and of itself is a significant achievement in lieu of the complexity and number of post-translationally modi ed amino acids included ... residues Thr10 and Ala12 and the carbohydrate moieties of GalNAc (GN) and Gal (G) The individual amino acids Thr10, Ala12 are represented by 10T and 12A, respectively, while GNH1 and GNH3 represents...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Fluorescence and FTIR study of pressure-induced structural modifications of horse liver alcohol dehydrogenase (HLADH) potx
... (NAD+ and ethanol) seemed to be strongly decreased The Km values for NAD+ and ethanol, at atmospheric pressure and at 225 MPa, were 18.92 ± 1.97 lM and 561.82 ± 68.93 lM, 0.56 ± 0.03 mM and 24.51 ... domain) and yellow (catalytic domain); tryptophans 15 and 314 are shown in red and NAD+ is shown in white Ó FEBS 2003 wavelength of the emitted light seems to be a better indication and can be ... structural modi cations (between 100 and 400 MPa), were )41.5 ± 4.6 mLÆmol)1 and +10.7 ± 1.2 kJÆmol)1, respectively The pressure of half-denaturation was 260 MPa The value of the apparent molecular standard...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: Autophosphorylation of heme-regulated eukaryotic initiation factor 2a kinase and the role of the modification in catalysis doc
... (2177130 and 21117501) and T.S (17101002), and Special Education and Research Expenses from the Ministry of Education, Culture, Sports, Science, and Technology of Japan References Trypsin digestion and ... is the marker band Only in the presence of heme (lanes and 4) were interactions between His6NTD and KD detected In the absence of heme (lanes and 3), interactions between His6-NTD and KD were not ... lanes and versus lanes and 4; Fig 2), which is consistent with previous studies [17] However, the interactions between His6-NTD and dephosphorylated KD were stronger than those between His6-NTD and...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Perturbation of membrane microdomains in GLC4 multidrug-resistant lung cancer cells ) modification of ABCC1 (MRP1) localization and functionality docx
... blotting and dot blotting of the analytical density gradients (Figs and 6) Fraction represents the top of the gradient, and fraction 11 is the bottom of the gradient Fractions and and fractions and ... found in fraction (70%) and in fraction (30%) Immunodetection of MRP1 in the absence (B) and in the presence (C) of treatment with MbCD S and R stand for GLC4 (sensitive) and GLC4 ⁄ ADR (resistant) ... concentrations Va° and V MbCD are the rates of MRP1-mediated efflux a of PIRA, before and after, respectively, treatment with MbCD [Chol]° and [Chol]MbCD are the cellular cholesterol contents before and after...
Ngày tải lên: 30/03/2014, 09:20
mundy - name reactions and reagents in organic synthesis 2e (wiley, 2005)
... page Intentionally Left Blank NAME REACTIONS AND REAGENTS IN ORGANIC SYNTHESIS This page Intentionally Left Blank NAME REACTIONS AND REAGENTS IN ORGANIC SYNTHESIS Second Edition Bradford P Mundy ... Ellerd, Name Reactions and Reagents in Organic Synthesis, John Wiley and sons, Inc., New York, 1988; M B Smith, J March in March's Advanced Organic Chemistv, 51h ed., John Wiley and Sons, Inc., New ... Inglis and K C Roberts Organic Syntheses m, 235 Base O 'E t uOEt - See M B Smith, J March in March's Advanced Organic Chemistty, 51h ed., John Wiley and Sons, Inc., New York, 2001, p 549; and C...
Ngày tải lên: 03/04/2014, 12:16