or unfolding a single block of code

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx

... reoxygenation, incorporation of radioactivity increased strongly within a very short interval and decreased 6–8 h later The profile of [3H]Thd incorporation after reoxygenation appears double-peaked ... 10 h, when maximal incorporation was attained This was followed by a decrease Under hypoxia, in contrast, incorporation decreased to a background level during the first h and remained at this level ... trypsinized for at °C and layered onto the top of 10–30% alkaline sucrose gradients [12] After denaturation of the DNA for h, centrifugation was performed at 20 000 r.p.m., 23 °C for 10 h in a Beckman...

Ngày tải lên: 21/02/2014, 00:20

11 610 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

... anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of epidurals per year) + (1.5 ... OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

Ngày tải lên: 05/03/2014, 15:20

14 610 0
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

... bilingual parallel corpora for crosslingual textual entailment In Proc of ACL-11, pages 1336–1345 Rada Mihalcea, Ravi Sinha, and Diana McCarthy 2010 SemEval-2010 Task 2: Cross-lingual lexical substitution ... Chenhao Tan, Claire Cardie, and Benjamin K Tsou 2011 Joint bilingual sentiment classification with unlabeled parallel corpora In Proc of ACL-11, pages 320–330 Yashar Mehdad, Matteo Negri, and Marcello ... (WIKIRED), or are automatic translations (WNTR / WIKITR) – and about their language and lemma In addition, translation relations among lexical items are represented as a mapping from source to target...

Ngày tải lên: 07/03/2014, 18:20

6 400 0
báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt

báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt

... formalin for hours, processed, and embedded in paraffin The other hemi-brain was snap frozen and stored at -80°C for biochemical analysis of A Anti -A antibody ELISA Anti -A antibodies in plasma ... immunohistochemistry and ELISAs, and guided or performed image analysis, analyzed data and drafted the manuscript LJ performed tissue preparation, immunohistochemistry, image analysisand ELISAs KT carried ... images was performed in a single session using a SPOT camera (Sterling Heights, MI) Computer-assisted image analysis was performed using IP Lab Spectrum 3.1 Image Analyzer software (Fairfax, VA),...

Ngày tải lên: 19/06/2014, 22:20

10 398 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... response against tetanus toxoid vaccine was expressed as absolute titers of antibodies Serum samples for the quantification of abatacept were collected at baseline, prior to vaccinations, and at the ... days after vaccination (μg/ml) 28 days after vaccination (μg/ml) N /A N /A N /A N /A N /A 28.6 (26) Group C (vaccines weeks after abatacept) N /A 12.5 (19) 6.1 (20) Group D (vaccines weeks after abatacept) ... there was presumably a pool of B cells that had completed their differentiation into antibody-secreting plasma cells before abatacept was administered Abatacept prevents the activation of naive...

Ngày tải lên: 09/08/2014, 10:20

11 415 0
Báo cáo y học: " Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report" pps

Báo cáo y học: " Severe refractory autoimmune hemolytic anemia with both warm and cold autoantibodies that responded completely to a single cycle of rituximab: a case report" pps

... hemolytic anemia The cause of AIHA remains idiopathic in 50% of the cases [1] The clinical presentation of AIHA depends on the subclass type: warm agglutinin, cold agglutinin and mixed disorder, as ... publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Conflict of interests The authors declare that ... 62-year-old Caucasian man with a history of chronic alcohol abuse presented to the emergency department with complaints of shortness of breath and confusion of three days’ duration The patient’s...

Ngày tải lên: 11/08/2014, 00:23

5 368 0
Báo cáo y học: " Ingestion of 10 grams of whey protein prior to a single bout of resistance exercise does not augment " doc

Báo cáo y học: " Ingestion of 10 grams of whey protein prior to a single bout of resistance exercise does not augment " doc

... key regulator Maximal activation of Akt occurs through phosphorylation of Ser473 and it appears that Akt may have a relatively short period of activation after an acute bout of resistance exercise ... reflective of their normal dietary intake Dietary inventories were then analyzed for average energy and macronutrient intake using the ESHA Food Processor Nutritional Analysis software (Salem, OR, USA) ... donate blood and muscle biopsy samples This work was supported by Glanbia Nutritionals, Twin Falls, ID, USA and the Exercise and Biochemical Nutrition Laboratory at Baylor University Author details...

Ngày tải lên: 11/08/2014, 23:21

9 193 0
Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt

Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt

... Szilvasy I, Paragh G, Pauliny Z, Bartha K, Visontay I, Kis A, Jankovics I: A single- dose influenza A (H5N1) vaccine safe and immunogenic in adult and elderly patients: an approach to pandemic vaccine ... vaccine has lots of advantages It induces balanced immune responses and can be prepared in a short time and on a large scale, with high purity and stability [23] It seems that DNA vaccine is a ... Kimachi K, Kino Y, Harada S, Yoshida K, Tochihara S, Itamura S, Odagiri T, Tashiro M, Okada K, et al: Immunogenicity of an inactivated adjuvanted whole-virion influenza A (H5N1, NIBRG-14) vaccine...

Ngày tải lên: 12/08/2014, 04:20

9 381 0
Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

... AMV-RT, and respective sense and antisense primers [(D1: 5'-TCAATATGCTGAAACGCGCGAGAAACCG-3') (D2: 5'-TTGCACCAACAGTCAATGTCTTCAGGTTC-3')] [26] in a thermal cycler (BioRad, USA) The thermal profile of ... JA Hospital, Gwalior and Dr Ashok Rawat, Deputy Health Officer, Municipal Corporation of Delhi, for providing the clinical samples HK also acknowledges partial financial support form Council of ... Southeast Asian J Trop Med Public Health 2001, 32:326-35 Kukreti H, Chaudhary A, Rautela RS, Anand R, Mittal V, Chhabra M, Bhattacharya D, Lal S, Rai A: Emergence of an independent lineage of dengue...

Ngày tải lên: 12/08/2014, 04:21

9 464 0
PicturePath A single row of photos carries your reader from here to there.

PicturePath A single row of photos carries your reader from here to there.

... format Print: (Specify pages 9–12) Print Format: Landscape Page Size: Fit to Page Save Presentation format or Paper-saver format  Back | Paper-saver format  Build a picture path SNOWBOARDING ... Before&After BAmagazine.com ® i U X Build a picture path It’s out of the ordinary, attractive and easy, too a single row of photos carries your reader from here to there Here’s an easy way to make ... to Before & After Before & After magazine Before & After has been sharing its practical approach to graphic design since 1990 Because our modern world has made designers of us all (ready or not),...

Ngày tải lên: 01/03/2016, 22:20

12 314 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19] ... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... forms Parallel analysis of the supernatants revealed a positive signal starting at 60 of chase and having a molecular mass (82 kDa) consistent with a fully mature form This band was not observed...

Ngày tải lên: 23/03/2014, 13:20

7 364 0
application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

... the stations into a surface model and take advantage of the capabilities of hull surface modeling, compare it to the target offsets, and refine it as necessary until a satisfactory match is achieved ... versa An interesting of Gregory’s square was developed by Chiyokura and Kimura (1984) As a result, boundary interpolating patch has several drawbacks for modification a large number of small ... problem, and it must also avoid round off error magnifications in back- substitution calculation and large storage capacity (Mathews and Fink 1992) This approach required mathematical knowledge in order...

Ngày tải lên: 13/11/2014, 08:18

113 521 1
Analysis of the mechanical reaction of human endothelial cells to a single constant or transient uniaxial strain

Analysis of the mechanical reaction of human endothelial cells to a single constant or transient uniaxial strain

... Northampton, MA, USA) Cell force analysis was performed using a MATLAB 7.14 standalone (MathWorks, Natick, MA, USA) Statistical tests were performed using R 3.0.2 (The R Foundation for Statistical ... of ImageJ 1.44p [41], [42] macros and plug-ins, and the primary data processing and visualization were done in ImageJ, MATLAB 7.11 (MathWorks, Natick, MA, USA) and Origin 8.1 G (OriginLab, Northampton, ... Germany) to the main standalone program for cell force analysis 17 2.4.4 Cell Force Analysis The algorithms for cell force analysis (CFA) were developed in MATLAB and are described in detail...

Ngày tải lên: 19/11/2015, 15:46

84 346 0
 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... to an amplitude histogram, which generates a large inventory of normalized mathematical indexes of abnormality It is the pattern of these mathematical indexes of abnormality, obtained from analysis ... were analyzed using the same software and hardware located at the central server location in New York All MCG analyses in this database have been validated against the final medical and angiographic ... Scanlon PJ, Faxon DP, Audet AM, et al ACC/AHA guidelines for coronary angiography: executive summary and recommendations A report of the American College of Cardiology/American Heart Association...

Ngày tải lên: 03/11/2012, 10:58

13 684 0
Tài liệu Connecting to a Named Instance of SQL Server or Microsoft Data Engine (MSDE) docx

Tài liệu Connecting to a Named Instance of SQL Server or Microsoft Data Engine (MSDE) docx

... the Data Source attribute for a named instance Each instance operates independently of the other instances installed on the same computer Each instance has its own set of system and user databases ... Coordinator (DTC) and the Microsoft Search services are installed and used simultaneously by every installed instance of SQL Server Client tools such as Enterprise Manager and Query Analyzer are also ... also shared The System.Data.SqlClient class cannot automatically discover the port number of a named instance of SQL Server listening on a port other than the default 1433 To connect to a named...

Ngày tải lên: 14/12/2013, 18:16

3 406 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx

... analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana, ... snakes and Japanese white rabbits were acquired, maintained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH, USA; revised 1985) Analytical methods DNase ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and...

Ngày tải lên: 20/02/2014, 23:20

8 500 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs did not mark any as poor or inappropriate Another ... lengths and angles were close to the optimal value of Ramachandran plot, backbone conformation and chi-1/chi-2 rotamer normality correspond to Z-scores and therefore a positive value indicates better...

Ngày tải lên: 21/02/2014, 00:20

12 550 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt

... via a short antiparallel b-sheet Ca2+ is coordinated by the mainchain carbonyl and side-chain carboxyl oxygens at the 12- or 14-residue loop One pair of EF-hands usually forms a globular domain ... ‘punctae’ and aggregates near the plasma membrane [1,6] The N-terminal region of STIM1 contains a canonical EF-hand motif and a predicted SAM domain Stathopulos et al [23,24] isolated the EF-SAM ... domains gate and regulate Orai channels Nat Cell Biol 11, 337–343 Spassova MA, Soboloff J, He LP, Xu W, Dziadek MA & Gill DL (2006) STIM1 has a plasma membrane role in the activation of store-operated...

Ngày tải lên: 07/03/2014, 00:20

9 465 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...

Ngày tải lên: 07/03/2014, 12:20

16 397 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... This unusual feature was attributed to a major change in the supramolecular organization of the peripheral antenna The absence of LHCII oligomers in these strains leads to the accumulation of LHCII ... and mf2 mutants were originally screened as unusual PSII mutants because they lack variable fluorescence – a signature of the absence of PSII [15] – but have a low (instead of a high) fluorescence...

Ngày tải lên: 07/03/2014, 15:20

10 411 0
w