openstream  as a bridge to java

... Cardiopulmonary by-pass assistance was again considered, but still unavailable, why an IcyCath® catheter (Alsius Corp., CA, USA) was placed in the femoral vein for rewarming and temperature control ... speculated on; one reason may be that his airway was secured at an earlier time than patient The potential benefit of younger age in cases of accidental hypothermia and submersion has been addressed ... on day three that only partly responded to treatment with bensodiazepines After eight days in the ICU, he was transferred to an ordinary ward and eventually to a rehabilitation facility He was...

Ngày tải lên: 13/08/2014, 23:20

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... as a protease to cleave HA which creates a systemic infection as well [1] Taubenberger [1] reported that this transformation was not observed in the1918 strain, or in strains “captured” in nature...

Ngày tải lên: 02/11/2012, 11:12

... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar ... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? not often lead to...

Ngày tải lên: 27/12/2013, 20:26

... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...

Ngày tải lên: 18/02/2014, 16:20

... friendly manner, graciously and courteously •  That you want to help them •  To see you as the solution to their problem, and not be seen as your problem •  To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...

Ngày tải lên: 19/02/2014, 14:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated...

Ngày tải lên: 06/03/2014, 22:21

... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test ... stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock treatment J Cell...

Ngày tải lên: 07/03/2014, 12:20

... those  measures  that  are  being  used  in the target areas as well as foreign countries,  such  as Indonesia,  China,  Bangladesh,  Germany,  Mexico,  Colombia,  USA.  Some  of  them are introduced as follows.  ... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... and  accounts  for  75%  to 85%  of  the  total  yearly  rainfall,  whereas  the  dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.  ...

Ngày tải lên: 22/03/2014, 12:20

... (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the earlier stage will be analyzed and taken ... two main reasons First, many autonomy experts suggest it as an option to approach the problem According to Little [15], students are not automatically autonomous in the formal classroom The teacher’s ... The teacher strongly believes that autonomy helps learning and that learner training can contribute to promoting learner autonomy Information about learner beliefs about language learning, learner...

Ngày tải lên: 28/03/2014, 11:20

... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94, ... the art Minerva Biotec 14, 121–128 137 Nishiura H, Shibuya Y, Matsubara S, Tanase S, Kambara T & Yamamoto T (1996) Monocyte chemotactic factor in rheumatoid arthritis synovial tissue Probably a...

Ngày tải lên: 30/03/2014, 15:20

... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... installation of the hypobaric chamber and annexed facilities We are also grateful to Mr Juan A Silva from Universidad de Antofagasta (Chile) by his collaboration in some data collection, and to ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...

Ngày tải lên: 18/06/2014, 15:20

... PSA as a tumour marker and ALP as a bone formation marker Methods This imaging study was performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases ... in clinical trials, to the extent that bone metastases are often regarded as a non-measurable disease [4] Criteria exist which use radiographic changes to measure response in bone metastases, but ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured...

Ngày tải lên: 21/06/2014, 02:20

... Buildings are the basic components of smart grids The smart grid vision assumes all buildings will have a small renewable energy source installed and in case of increase of demand it can act as a small ... Edgar Morin observed that Pascal had posited precisely that “all things being caused and causing, assisted and assisting, mediate and immediate, and all of them joined by an intangible natural ... fails to properly assess cities (Salat & Bourdic, 2011) Classical thermodynamics is fundamentally based on reductionist assumptions: any system can be analyzed as the sum of its elements As authors...

Ngày tải lên: 28/06/2014, 17:20

... Create Computer Viruses Virus writers can have various reasons for creating and g spreading malware Viruses have been written as: • • • • • • • • • Research projects Pranks Vandalism To attack ... load than normal Computer's hard drive constantly runs out of free space Files have strange names which are not recognizable Programs act erratically Resources are used up easily Hardware Threats ... program ti due to i l t f data in Software Attacks: • Intentionally launched malicious programs enable the attacker to use the computer in an unauthorized manner • General Categories: • Viruses and...

Ngày tải lên: 31/07/2014, 04:20

... purified, assembled and characterized in batches of 96 RNAP variants over 1-2 days, making large-scale analysis of systematically designed RNAP substitution mutants feasible In addition, the approach ... colleagues [7] Their approach takes advantage of a completely recombinant system for production of the RNAP from the archaeon Methanocaldococcus jannaschii This recombinant archaeal polymerase is composed ... the bridge helix as well as some within the trigger loop It was already known that certain trigger-loop substitutions in bacterial RNAP and yeast RNA polymerase II (Pol II) allow the enzymes to...

Ngày tải lên: 06/08/2014, 18:21

... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type ... protein analysis The cartilage used for RNA quantification was diced and incubated with RNAlater (Qiagen Inc., Valencia, CA, USA) overnight at 4°C prior to storage Available online http://arthritis-research.com/content/8/5/R149 ... from animals cannot always be extrapolated to humans Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in loadbearing areas On...

Ngày tải lên: 09/08/2014, 08:22

... (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg suspension ... USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the data in the figures The data were analyzed using two-way analysis of variance ... M, Aota S, Omata T, Tuzuike N, Itokazu Y, Oka H, Tamaki H, Nakamura T: Methotrexate maintains bone mass by preventing both a decrease in bone formation and an increase in bone resorption in adjuvant-induced...

Ngày tải lên: 09/08/2014, 10:21

... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs (24!, the average number...

Ngày tải lên: 09/08/2014, 18:21