objectives 6 3 and 6 5

scjp sun certified aprogrammer for java platform 6th ed

scjp sun certified aprogrammer for java platform 6th ed

... Waiting and Timed-Waiting Threads Terminated Threads Thread Synchronization The Monitor Lock The wait, notify, and notifyAll Methods Summary 34 2 34 3 34 4 3 46 34 9 34 9 35 1 35 3 35 3 35 5 35 5 35 8 36 3 36 8 ... Answers to Review Questions Chapter 281 281 2 83 2 85 2 85 287 289 291 294 2 95 298 30 1 30 1 30 3 30 4 3 06 3 06 31 2 31 5 31 5 32 0 32 2 32 4 32 5 3 26 33 7 Concurrency 34 1 Overview of Threads Writing a Thread Implementing ... Questions 88 89 90 91 93 95 97 100 102 104 1 05 108 111 114 1 16 1 16 118 121 124 1 26 128 131 134 1 35 137 138 140 1 43 144 147 147 149 150 151 152 152 158 159 162 1 65 166 168 1 83 Contents Chapter Flow...

Ngày tải lên: 27/10/2014, 00:57

583 330 0
Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

... Negative 56 ELISA Ig G Positive 23 / 32 0 44 35 23 21 37 / 64 0 18 13 16 17 1 / 1280 / 2 56 0 37 14 18 11 19 27 12 10 30 13 1 / 51 20 21 19 18 20 1 / 10240 10 8 1 23 77 122 78 159 41 Immuncapture Number of ... comparison Test Sensitivity Spesifity PPD NPD ELISA 90,0 66 ,7 91,1 63 ,6 Immuncapture 90 ,6 76, 3 94,2 65 ,9 IgG 73, 7 58 ,9 84,2 42,8 IgM 72,2 67 ,8 85, 2 48,7 PPD: positive predictive value NPD: negative ... predictive and positive predictive values were found to be 90 ,6 %, 76, 3 %, 94,2 %, and 65 ,9 % respectively for the Immuncapture test, whereas they were found to be 73, 7 %, 58 ,9 %, 84,2 %, and 42,8...

Ngày tải lên: 25/10/2012, 10:56

5 606 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

... 9.8 3 .6 3. 4 3. 1 4.2 3 .6 5. 0 6. 0 2 .6 2 .6 44.71 44. 85 44.88 44. 83 45. 29 46. 32 43. 16 43. 52 930 67 50 2 36 5 828 1 950 4 65 4 54 7 4000 EIS, Alternative Ref [ 16] Powell 40001 OF 44. 73 (US$/MWh) 29 85 NC ... 109 .3 S14.p (bar) 3. 0 3. 0 9.4 2.0 2.0 9.1 50 0.0 50 0.0 0.08 9.1 50 0.0 50 0.0 0.08 9.1 51 9.9 52 2.2 0.08 9 .3 51 5.4 50 2.4 0.08 9 .5 5 16. 2 5 16. 3 0.08 9.1 50 5 .3 52 2.2 0.08 9.8 5. 0 2.7 3. 9 3. 1 5. 0 2 .6 44.98 ... 117.7 3. 0 50 0.0 50 0.0 0.08 9.1 0. 75 0.74 1 05. 9 3. 0 50 0.0 50 0.0 0.08 9.1 0. 75 0. 75 76. 3 6. 3 4 96. 1 50 5.9 0.17 6. 1 0.74 0. 75 119.8 10.0 51 9.0 51 9.0 0.08 9.9 0. 53 0.71 108.2 9.4 51 9.9 52 2.2 0.08 9 .3 5. 0...

Ngày tải lên: 05/09/2013, 16:30

14 594 0
Tài liệu Bài 3: Gradients and Optimization Methods ppt

Tài liệu Bài 3: Gradients and Optimization Methods ppt

... x x w X =1 X2 (t) = (3. 35) (t) < (3. 36 ) t =1 t wx and the nonlinearity g ( ) satisfies some technical assumptions [2 53 ] , then it can be shown that the on-line algorithm (3. 32) must converge to ... changes, and adapt quickly to the changing environment Example 3 .6 In Chapter 6, on-line PCA is discussed One of the learning rules is as follows: w / xy wx y2 w (3. 37) x where y = T and is a random ... gradient 3. 3 m 3. 4 3. 5 ( ) + log det Consider the 2 =( ) matrix W = a b c d W 3. 5. 1 Compute the cofactors with respect to the first column, compute the determinant, the adjoint matrix, and the...

Ngày tải lên: 13/12/2013, 14:15

20 408 0
Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

... ( 15. 26) For comparison, the line x = y is given by dotted line All the densities were normalized to unit variance, and noise variance was fixed to :3 1 .5 0 .5 −2 .5 −2 −1 .5 −1 −0 .5 0 .5 1 .5 2 .5 Fig ... of the maximum likelihood estimator, introduced in [33 ], and a rather different approach for narrow-band sources, introduced in [ 76] m 15. 5 15. 5.1 m m s ESTIMATION OF THE NOISE-FREE INDEPENDENT ... ( 15. 23) and ( 15. 25) W x Compute for each noisy observation (t) the corresponding noisy sparse components (t) = (t) Apply the shrinkage nonlinearity gi (:) as defined in ( 15. 24), or in ( 15. 26) ,...

Ngày tải lên: 20/01/2014, 11:20

13 379 0
PID ALGORITHM  AND TUNNING METHODS

PID ALGORITHM AND TUNNING METHODS

... intercept of tangent line and original process value The gain, reset, and Derivative are calculated using: Gain P X/DR Reset Derivative — — 0 .3/ D PI 0.9X/DR — 0 .5/ D PID 1.2X/DR 0.5D Ziegler Nichols ... change in output (%) The gain, reset, and Derivative are calculated using: Gain P L/GpD Reset Derivative — — 0 .3/ D PI 0.9 L/GpD — 0 .5/ D PID 1.2 L/GpD 0.5D Ziegler Nichols tuning method: closed ... proportional and integral only Calculation of repeat time: (gain and reset terms used in controller) With the error set to zero (measurement input = setpoint), make a change in the input and note...

Ngày tải lên: 22/01/2014, 08:26

40 491 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

... soldier, and Thompson is a soldier, and Smith is a soldier, but we can not say, Jones is the 76th regiment, and Thompson is the 76th regiment, and Smith is the 76th regiment We can only say, Jones, and ... Thompson, and Smith, and Brown, and so forth (enumerating all the soldiers), are the 76th regiment “The 76th regiment” is a collective name, but not a general one: “a regiment” is both a collective and ... analysis Logic is common ground on which the partisans of Hartley and of Reid, of Locke and of Kant, may meet and join hands Particular and detached opinions of all these thinkers will no doubt occasionally...

Ngày tải lên: 06/03/2014, 13:20

1K 548 0
Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

... Journal,vol.2 93, No .3, (March 1987),pp. 53 3 -5 36 Toth-Pal, E.; Papp, C.;Beke, A.; Ban, Z.; Papp, Z.(2004) Genetic amniocentesis in multiple pregnancy Fetal Diagnosis and Therapy , vo.19,No .6, (June 2004),pp. 138 -144 ... vol.1 93, No5 -6, (June 20 05) ,pp .39 5- 4 03 Monni,G.;Ibba,RM.;Lai,R.(19 93) .Early transabdominal chorionic villus sampling in couples at high genetic risk Am J Obstet Gynecol, vol. 168 ,No.1,(January 19 93) ,pp.170-171 ... a 155 9delT of the ALPL c. 155 9delT, a deletion of T at 155 9, which caused a frameshift downstream from leucine (Leu) at codon 5 03, resulted in the elimination of the termination codon at 50 8 and...

Ngày tải lên: 07/03/2014, 20:20

220 1,1K 0
POULTRY RATIONS and Feeding Methods ppt

POULTRY RATIONS and Feeding Methods ppt

... cracked wheat may be fed at three weeks, and a little whole wheat after four weeks Chick Starter No lbs 30 .0 18.0 15. 0 10.0 5. 0 5. 0 5. 0 3. 0 5. 0 1 .5 1 .5 0 .5 0 .5 Coursely Ground Wheat Coursely Ground ... Fish Oil (200 D) Manganese Sulphate (see below) 100.0 Turkey Starter lbs 25. 0 10.0 15. 0 10.0 5. 0 10.0 10.0 4.0 7.0 1 .5 1.0 0 .5 1.0 100.0 To each ton of chick or turkey starter mash, add ounces of ... pullets in fall and winter may lead to numerous double-yolked and shell-less eggs, feather-picking, prolapse, and cannibalism, as well as loss in weight and moulting If production reaches 60 per cent,...

Ngày tải lên: 23/03/2014, 21:20

12 617 1
International Macroeconomics and Finance: Theory and Empirical Methods pptx

International Macroeconomics and Finance: Theory and Empirical Methods pptx

... 751 0.0 - 266 2 .5 4847 .5 - 450 0.0 34 7 .5 8912 .5 9 260 .0 1 36 0 0.0 22 860 .0 - 56 2 5. 0 17 2 35 .0 3 962 .5 21197 .5 2012 .5 232 10.0 - 56 5 0.0 17 56 0 .0 63 7 .5 18197 .5 T k 1. 058 1 1. 062 8 1.0479 1.0418 1.0 36 5 1. 033 0 1. 030 8 ... 0.88 15 0. 85 96 0.89 76 0.8790 0. 852 4 0.8401 0. 857 5 0.8 4 63 FT k 0.0000 0. 037 4 -0.02 13 -0.0 36 0 0.07 13 0.1088 -0.0 450 0. 031 7 0.0 161 -0.0 452 0.0 051 Long yen position (FT k VT ) Margin 0.0 2 8 35 .0 467 5. 0 ... Date 6/ 16/ 98 6/ 17/98 7/17/98 8/17/98 9/17/98 10/ 16/ 98 11/17/98 12/17/98 01/19/99 02/17/99 03/ 17/99 FT k ST k 0. 73 46 0 .69 42 0.772 0.7 2 63 0. 750 7 0.7 1 63 0.7147 0 .68 59 0.7 860 0. 758 2 0.8948 0. 866 1 0.8498...

Ngày tải lên: 24/03/2014, 04:20

376 776 0
Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

... Assessment 56 Sizing-Method Application 57 CHAPTER SIX Approaches to Cost Estimation 61 Using Cost Estimates 62 Buyers 63 Developers 63 Users 64 Researchers ... Tables 3. 1 Initial Function-Point Count 28 3. 2 Object-Point Calculation 33 3. 3 Application Points 34 xiii Executive Summary Introduction (see pp 1–7) Estimating the size and cost ... into Function or Feature Points 28 3. 3 Transforming Characteristics into Object Points 31 3. 4 Using Analogies to Generate a Size Estimate 38 3. 5 Generating a Size Estimate from Use Cases...

Ngày tải lên: 29/03/2014, 18:20

127 326 0
Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

... thorobreds and decided to embark himself in fowls He decided upon White Leghorns but had only 50 cents I loaned him 50 cents until cherry picking time and he found an advertisement of 25 eggs for ... to go slow and get the best Rather buy one setting of $5 eggs than 100 eggs for $5 for the chicks from the $5 setting eggs will likely be worth more than a dozen raised from the $5 per 100 eggs ... task a recreation for the other and to come away from the city and office with its cares and intense mental exertion and hurry out to the poultry headquarters and attend to a nice flock of busy...

Ngày tải lên: 31/03/2014, 08:20

132 364 0
an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

... 0 .50 000000000000 0 .33 333 333 333 333 3. 14 159 2 65 35 8979 >> format rat; s s = 1/2 1 /3 355 /1 13 >> format ; s s = 0 .50 00 0 .33 33 3.14 16 1.4142 139 3/9 85 1.4142 13 56 2 37 310 1.4 Vectors in MATLAB 13 There are other ... N 3. 3.1 Sums of Series of the Form 63 63 63 68 j p , p ∈ N 73 j=1 3. 4 3. 5 3 .6 3. 7 3. 8 3. 3.2 Summing Infinite Series 3. 3 .3 Summing Series ... s.ˆ2 ans = 16 25 36 2 .50 00 6. 0000 1 .5 Setting Up Mathematical Functions 17 >> 1./s ans = 1.0000 0 .50 00 0 .33 33 0. 250 0 0.2000 0. 166 7 1.0000 1 .50 00 2.0000 2 .50 00 3. 0000 >> s/2 ans = 0 .50 00 >> s+1...

Ngày tải lên: 08/04/2014, 09:57

468 601 0
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

... 57 57 58 58 59 59 60 60 61 61 62 62 63 63 The Budding and Fission Yeasts 64 64 65 65 66 66 67 67 68 68 69 69 70 70 71 71 72 72 73 73 74 74 75 75 76 76 77 77 78 78 79 79 80 80 23 Berry, L D., Feoktistova, ... CDC27 and CDC 16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B Cell 81, 279–288 44 44 45 45 46 46 47 47 48 48 49 49 50 50 51 51 52 52 53 53 54 54 55 55 56 56 57 57 58 58 59 59 ... 81, 66 7 67 6 82 82 83 83 84 84 85 85 86 86 87 87 88 88 89 89 90 90 91 91 92 92 93 93 94 94 95 95 96 96 97 97 The Budding and Fission Yeasts 98 98 99 99 100 100 101 101 102 102 1 03 1 03 104 104 105...

Ngày tải lên: 08/04/2014, 12:50

409 879 0
directed enzyme evolution, screening and selection methods

directed enzyme evolution, screening and selection methods

... canavanine and auxotrophy for Leu2, Ura3, and/ or Trp1, His3, Lys2 markers We used YGL27-3D (MATa, leu2 his3 trp1 lys2 ura3 CAN1, pol3::KanMX) engineered by Simon and co workers (6) and Singh and co ... 7 56 758 (–11 to –8) Round R3 – R3 – 32 R3 – 26 R3 – 17 R3 – R3 – 29 Asn Asn Asn Ala Phe Thr Arg Arg Arg Met Gly Lys Cys Cys Cys Ser Ile Gln GACT GACG TGTA GGTA GCTA GACT Round R4 – 14 R4 – 16 ... 1 43 147 Landis D M., Heindel C C., and Loeb, L A (2001) Creation and characterization of 5- fluorodeoxyuridine-resistant Arg50 loop mutants of human thymidylate synthase Cancer Res 61 , 66 6 67 2...

Ngày tải lên: 11/04/2014, 00:40

361 263 0
telomeres and telomerase, methods and protocols

telomeres and telomerase, methods and protocols

... Fletcher, R., and Razvi, H (2000) Comparison of human telomerase Introduction to Telomeres and Telomerase 52 53 54 55 56 57 58 59 60 61 62 11 reverse transcriptase messenger RNA and telomerase ... proterminal regions Genomics 36 , 492 – 5 06 33 Meltzer, P S., Guan, X Y., and Trent, J M (19 93) Telomere capture stabilizes chromosome breakage Nat Genet 4, 252 – 255 34 Landegent, J E.; Jansen in ... F., McFarlane, R., et al (1998) Cloning and characterization of human and mouse telomerase RNA gene promoter sequences Oncogene 16, 134 5 – 1 35 0 33 Bachand, F and Autexier, C (2001) Functional regions...

Ngày tải lên: 11/04/2014, 07:12

236 344 0
hplc of peptides and proteins, methods and protocols

hplc of peptides and proteins, methods and protocols

... ( 25 C) Cation exchange 2.00 1 .5 2 .5 2.88 2.4 3. 4 3. 13 2 .6 3 .6 3. 81 3 .6 4 .3 3. 75 3. 8–4 .3 4.21 4 .3 4.8 4. 76 4.8 5. 2 5 .68 5. 0 6. 0 7.20 6. 7–7 .6 7 .55 7 .6 8.2 8 . 35 8.2–8.7 Anion exchange 4. 75 4 .5 5. 0 ... 4. 75 4 .5 5. 0 5 .68 5. 0 6. 0 5. 96 5. 5 6. 0 6. 46 5. 8 6. 4 6. 80 6. 4–7 .3 7. 76 7 .3 7.7 8. 06 7 .6 8 .5 8 .52 8.0–8 .5 8.88 8.4–8.8 8 .64 8 .5 9.0 9 .50 9.0–9 .5 9. 73 9 .5 9.8 10.47 9.8–10 .3 11.12 10 .6 11 .6 a Concentration ... Wt ~1 14 .6 14 .6 14.9 15. 0 15. 2 15 .3 16. 8 17.0 17 .3 19 .5 10.7 11.0 1 35 ,50 0 1 43, 000 66 0,000 168 ,000 480,000 120,000 1 15, 700 64 ,000 117 ,50 0 129,000 1 25, 700 112,000 114 ,30 0 Data from refs and The...

Ngày tải lên: 11/04/2014, 09:46

395 367 0
mrna processing and metabolism, methods and protocols

mrna processing and metabolism, methods and protocols

... Dev 15, 33 19 33 29 16 Morris, D P., Phatnani, H., and Greenleaf, A L (1999) Phospho-CTD binding and the role of a prolyl isomerase in pre-mRNA 3' end formation J Biol Chem 274, 31 ,5 83 31 ,58 7 17 ... Biol 13, 5 461 5 468 15 Jensen, K B., Dredge, B K., Stefani, G., et al (2000) Nova-1 regulates neuronspecific alternative splicing and is essential for neuronal viability Neuron 25, 35 9 37 1 16 Carstens, ... CCCAACTGAAGGCTAGGCTGTGG PMA1 p, 37 0 PMA1 p, –70 PMA1 cds1, + 168 PMA1 cds1, +3 76 PMA1 cds2, +1010 PMA1 cds2, +1 2 35 PMA1 cds3, +2018 PMA1 cds3, +2290 PMA1 cds4, +58 4 PMA1 cds4, +807 PMA1 3' UTR top PMA1 3' UTR bottom...

Ngày tải lên: 11/04/2014, 09:53

267 340 0
w