objectives 6 3 and 6 4

scjp sun certified aprogrammer for java platform 6th ed

scjp sun certified aprogrammer for java platform 6th ed
Ngày tải lên : 27/10/2014, 00:57
... Wildcards Working with Lists Sorting Lists Searching Lists 42 5 4 26 4 26 43 2 43 3 4 36 4 36 43 8 44 1 44 5 44 9 45 0 45 1 4 53 45 5 45 8 46 1 46 1 46 7 Contents xvi Working with Arrays Sorting Arrays Searching ... Waiting and Timed-Waiting Threads Terminated Threads Thread Synchronization The Monitor Lock The wait, notify, and notifyAll Methods Summary 34 2 34 3 34 4 3 46 34 9 34 9 35 1 35 3 35 3 35 5 35 5 35 8 36 3 36 8 ... Questions 88 89 90 91 93 95 97 100 102 1 04 105 108 111 1 14 1 16 1 16 118 121 1 24 1 26 128 131 1 34 135 137 138 140 1 43 144 147 147 149 150 151 152 152 158 159 162 165 166 168 1 83 Contents Chapter Flow...
  • 583
  • 330
  • 0
  1. Công Nghệ Thông Tin
  2. Kỹ thuật lập trình
Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"
Ngày tải lên : 25/10/2012, 10:56
... Positive 23 / 32 0 44 35 23 21 37 / 64 0 18 13 16 17 1 / 1280 / 2 560 37 14 18 11 19 27 12 10 30 13 1 / 5120 21 19 18 20 1 / 10 240 10 8 1 23 77 122 78 159 41 Immuncapture Number of Positive sample 144 Negative ... comparison Test Sensitivity Spesifity PPD NPD ELISA 90,0 66 ,7 91,1 63 ,6 Immuncapture 90 ,6 76, 3 94, 2 65 ,9 IgG 73, 7 58,9 84, 2 42 ,8 IgM 72,2 67 ,8 85,2 48 ,7 PPD: positive predictive value NPD: negative ... predictive and positive predictive values were found to be 90 ,6 %, 76, 3 %, 94, 2 %, and 65 ,9 % respectively for the Immuncapture test, whereas they were found to be 73, 7 %, 58,9 %, 84, 2 %, and 42 ,8...
  • 5
  • 604
  • 0
  1. Y Tế - Sức Khỏe
  2. Y học thưởng thức
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
Ngày tải lên : 05/09/2013, 16:30
... 10.0 0. 53 0 . 64 109 .3 9.1 505 .3 522.2 0.08 9.8 3 .6 3. 4 3. 1 4. 2 3 .6 5.0 6. 0 2 .6 2 .6 44 .71 44 .85 44 .88 44 . 83 45 .29 46 . 32 43 . 16 43 . 52 930 67 50 2 36 5 828 1950 46 5 4 547 40 00 EIS, Alternative Ref [ 16] Powell ... 9 .4 519.9 522.2 0.08 9 .3 5.0 3. 4 5.0 5.0 3 .6 2.7 5 .6 3. 1 3. 9 44 . 64 44 .98 44 . 73 44 .68 44 .98 45 .80 43 . 01 43 . 46 7 23 540 0 1 241 45 5 2700 1700 47 5 40 00 OF 44 .97 (US$/MWh) 17 96 NC Mathematical optimization ... 0.08 9.1 3 .6 519.0 519.0 0.08 9.9 3. 1 518.8 518.8 0.08 9.2 3. 4 518.8 5 14. 0 0.08 9.0 3 .6 520.8 518.8 0.08 10.0 2 .6 OF (US$/MWh) 44 . 64 7 23 NC 44 .68 45 5 43 . 01 47 5 44 .71 930 44 . 83 828 43 . 16 547 o S08.t...
  • 14
  • 593
  • 0
  1. Khoa Học Tự Nhiên
  2. Môi trường
Tài liệu Bài 3: Gradients and Optimization Methods ppt

Tài liệu Bài 3: Gradients and Optimization Methods ppt
Ngày tải lên : 13/12/2013, 14:15
... x x w X =1 X2 (t) = (3. 35) (t) < (3. 36 ) t =1 t wx and the nonlinearity g ( ) satisfies some technical assumptions [2 53] , then it can be shown that the on-line algorithm (3. 32) must converge to ... changes, and adapt quickly to the changing environment Example 3 .6 In Chapter 6, on-line PCA is discussed One of the learning rules is as follows: w / xy wx y2 w (3. 37) x where y = T and is a random ... nonlinear optimization, for example, [ 46 , 135 , 2 84] , and their applications [172, 40 7] The speed of convergence of the algorithms is discussed in [2 84, 40 7] A good source for matrix gradients...
  • 20
  • 408
  • 0
  1. Tài Chính - Ngân Hàng
  2. Ngân hàng - Tín dụng
Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf
Ngày tải lên : 20/01/2014, 11:20
... unaffected by gaussian noise (see Section 2.7), and therefore any such estimation method would be immune to gaussian noise Such methods can be found in [ 63 , 2 63 , 47 1] The problem is, however, that such ... see Chapter 21 In that case, the method is closely related to wavelet shrinkage and “coring” methods [1 16, 4 03] 30 4 15.7 NOISY ICA CONCLUDING REMARKS In this chapter, we treated the estimation ... rinen, Juha Karhunen, Erkki Oja a Copyright  2001 John Wiley & Sons, Inc ISBNs: 0 -47 1 -40 540 -X (Hardback); 0 -47 1-22 131 -7 (Electronic) 15 Noisy ICA In real life, there is always some kind of noise...
  • 13
  • 379
  • 0
  1. Kỹ Thuật - Công Nghệ
  2. Hóa học - Dầu khí
PID ALGORITHM AND TUNNING METHODS

PID ALGORITHM AND TUNNING METHODS
Ngày tải lên : 22/01/2014, 08:26
... combinations of these elements: • Proportional only Proportional and Integral (most common) • Proportional, Integral, and Derivative • Proportional and Derivative • We will examine each of the three elements ... between the setpoint, the measurement, and the output Proportional—units The proportional or gain term may be calibrated in two ways: Gain and Proportional Band Gain = Output/Input Increasing the ... proportional and integral only Calculation of repeat time: (gain and reset terms used in controller) With the error set to zero (measurement input = setpoint), make a change in the input and note...
  • 40
  • 491
  • 0
  1. Giáo án - Bài giảng
  2. Cao đẳng - Đại học
mems advanced materials and fabrication methods nat aca press ppt

mems advanced materials and fabrication methods nat aca press ppt
Ngày tải lên : 05/03/2014, 15:20
  • 75
  • 1.8K
  • 0
  1. Kỹ Thuật - Công Nghệ
  2. Cơ khí - Chế tạo máy
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
Ngày tải lên : 06/03/2014, 13:20
... soldier, and Thompson is a soldier, and Smith is a soldier, but we can not say, Jones is the 76th regiment, and Thompson is the 76th regiment, and Smith is the 76th regiment We can only say, Jones, and ... Thompson, and Smith, and Brown, and so forth (enumerating all the soldiers), are the 76th regiment “The 76th regiment” is a collective name, but not a general one: “a regiment” is both a collective and ... analysis Logic is common ground on which the partisans of Hartley and of Reid, of Locke and of Kant, may meet and join hands Particular and detached opinions of all these thinkers will no doubt occasionally...
  • 1K
  • 548
  • 0
  1. Giáo Dục - Đào Tạo
  2. Cao đẳng - Đại học
Book 1 - Ethical and Professional Standards and Quantitative Methods pdf

Book 1 - Ethical and Professional Standards and Quantitative Methods pdf
Ngày tải lên : 07/03/2014, 04:20
  • 380
  • 360
  • 0
  1. Giáo Dục - Đào Tạo
  2. Cao đẳng - Đại học
Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx
Ngày tải lên : 07/03/2014, 20:20
... Brizot, ML.; Patel, F.(19 94) .Comparison of chorionic villus sampling and amniocentesis for fetal karyotyping at 10- 13 weeks' gestation Lancet ,vol . 34 4, No .3, (March 19 94) ,pp. 43 5 - 43 9 Nevo,Y.;Shomrat,R.;Yaron,Y.;Harel,S,Legum,C ... vol.108,No.12,(December 20 06) ,pp .61 2 61 6 Cederholm,M.;Haglund,B.;Axelsson,O.(20 03) .Maternal complications following amniocentesis and CVS for prenatal karyotyping BJOG,vol.110,No .4, (April 20 03) ,pp .39 2 -39 9 Department ... Obstet Gynecol, vo. 83, No .4, (April 19 94) ,pp .33 7 - 34 1 Elias,S.;Simpson,JL.(19 93) .Amniocentesis.In:Essentials of prenatal diagnosis Simpson, Jl.Churchill Livingstone:New York,pp.27 -44 Fergal, D.;Malone,...
  • 220
  • 1.1K
  • 0
  1. Giáo Dục - Đào Tạo
  2. Cao đẳng - Đại học
POULTRY RATIONS and Feeding Methods ppt

POULTRY RATIONS and Feeding Methods ppt
Ngày tải lên : 23/03/2014, 21:20
... pullets in fall and winter may lead to numerous double-yolked and shell-less eggs, feather-picking, prolapse, and cannibalism, as well as loss in weight and moulting If production reaches 60 per cent, ... winter laying rations and in rations for producing eggs for hatching, as a source of Vitamins A and D when the supply of green pasture and direct sunshine is limited or lacking Standard fish oils ... amount of mash and grain consumed, and allows one to use a cheap and simple growing ration Good pasture helps to grow sleek smoothlyfeathered vigorous pullets, enabling them to withstand the strain...
  • 12
  • 617
  • 1
  1. Nông - Lâm - Ngư
  2. Nông nghiệp
International Macroeconomics and Finance: Theory and Empirical Methods pptx

International Macroeconomics and Finance: Theory and Empirical Methods pptx
Ngày tải lên : 24/03/2014, 04:20
... 2 835 .0 46 7 5.0 7510.0 - 266 2.5 48 47.5 -45 00.0 34 7.5 8912.5 9 260 .0 1 36 0 0.0 22 860 .0 - 562 5.0 17 235 .0 3 962 .5 21197.5 2012.5 232 10.0 - 565 0.0 17 560 .0 63 7.5 18197.5 T k 1.0581 1. 062 8 1. 047 9 1. 041 8 1.0 36 5 ... 6/ 16/ 98 6/ 17/98 7/17/98 8/17/98 9/17/98 10/ 16/ 98 11/17/98 12/17/98 01/19/99 02/17/99 03/ 17/99 FT k ST k 0. 73 46 0 .69 42 0.772 0.7 2 63 0.7507 0.7 1 63 0.7 147 0 .68 59 0.7 860 0.7582 0.8 948 0. 866 1 0. 849 8 ... 0.8 244 0.8815 0.85 96 0.89 76 0.8790 0.85 24 0. 840 1 0.8575 0.8 4 63 FT k 0.0000 0. 037 4 -0.02 13 -0.0 36 0 0.07 13 0.1088 -0. 045 0 0. 031 7 0.0 161 -0. 045 2 0.0051 Long yen position (FT k VT ) Margin 0.0 2 835 .0...
  • 376
  • 776
  • 0
  1. Tài Chính - Ngân Hàng
  2. Ngân hàng - Tín dụng
Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx
Ngày tải lên : 29/03/2014, 18:20
... Object Points 31 3. 4 Using Analogies to Generate a Size Estimate 38 3. 5 Generating a Size Estimate from Use Cases 40 4. 1 Relationships Among Uncertainties and Errors 44 6. 1 (a) The Ideal ... 33 Predictive Object Points 34 Analogies 37 Estimating from Unified Modeling Language Constructs 39 CHAPTER FOUR Risk Checklist for Sizing Methods 43 Risks 44 ... Assessment 56 Sizing-Method Application 57 CHAPTER SIX Approaches to Cost Estimation 61 Using Cost Estimates 62 Buyers 63 Developers 63 Users 64 Researchers...
  • 127
  • 326
  • 0
  1. Giáo Dục - Đào Tạo
  2. Cao đẳng - Đại học
Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Building Plans for Poultrymen and Practical Methods of Poultry Raising doc
Ngày tải lên : 31/03/2014, 08:20
... task a recreation for the other and to come away from the city and office with its cares and intense mental exertion and hurry out to the poultry headquarters and attend to a nice flock of busy ... condition and health the fowls must be fed right, housed right and not crowded If your fowls seem out of condition, give them more park and house room Give plenty of sunshine and fresh air and water ... FOR POULTRYMEN 14 sell me his $40 house for $20 and song, as he was greatly disgusted with the "chicken business." and his whole trouble was in attempting too much, overcrowding, and failure to...
  • 132
  • 364
  • 0
  1. Nông - Lâm - Ngư
  2. Nông nghiệp
an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier
Ngày tải lên : 08/04/2014, 09:57
... 0.50000000000000 0 .33 333 333 333 333 3. 141 59 265 35 8979 >> format rat; s s = 1/2 1 /3 355/1 13 >> format ; s s = 0.5000 0 .33 33 3. 14 16 1 .41 42 139 3/985 1 .41 42 13 562 37 310 1 .4 Vectors in MATLAB 13 There are other ... N 3. 3.1 Sums of Series of the Form 63 63 63 68 j p , p ∈ N 73 j=1 3. 4 3. 5 3 .6 3. 7 3. 8 3. 3.2 Summing Infinite Series 3. 3 .3 Summing Series ... (((1/2) /3) /4) = 24 17 1/2 +3/ 4* 5 = + = , 4 5-2 *3* (2+7) = − 6( 9) = 49 , 16 × (−1) 4= − , 3 4 (2 -3* (4 -3) ) *4/ 5 = (2 − × 1) = − ; 5 (1 +3) *(2 -3) /3* 4 = which can be verified in MATLAB; we can use the command format...
  • 468
  • 601
  • 0
  1. Kỹ Thuật - Công Nghệ
  2. Điện - Điện tử
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks
Ngày tải lên : 08/04/2014, 12:50
... 57 57 58 58 59 59 60 60 61 61 62 62 63 63 The Budding and Fission Yeasts 64 64 65 65 66 66 67 67 68 68 69 69 70 70 71 71 72 72 73 73 74 74 75 75 76 76 77 77 78 78 79 79 80 80 23 Berry, L D., Feoktistova, ... containing CDC27 and CDC 16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B Cell 81, 279–288 44 44 45 45 46 46 47 47 48 48 49 49 50 50 51 51 52 52 53 53 54 54 55 55 56 56 57 57 58 ... 81, 66 7 67 6 82 82 83 83 84 84 85 85 86 86 87 87 88 88 89 89 90 90 91 91 92 92 93 93 94 94 95 95 96 96 97 97 The Budding and Fission Yeasts 98 98 99 99 100 100 101 101 102 102 1 03 1 03 1 04 1 04 105...
  • 409
  • 876
  • 0
  1. Khoa Học Tự Nhiên
  2. Sinh học
directed enzyme evolution, screening and selection methods

directed enzyme evolution, screening and selection methods
Ngày tải lên : 11/04/2014, 00:40
... 748 7 56 758 (–11 to –8) Round R3 – R3 – 32 R3 – 26 R3 – 17 R3 – R3 – 29 Asn Asn Asn Ala Phe Thr Arg Arg Arg Met Gly Lys Cys Cys Cys Ser Ile Gln GACT GACG TGTA GGTA GCTA GACT Round R4 – 14 R4 ... 17, 1 43 147 Landis D M., Heindel C C., and Loeb, L A (2001) Creation and characterization of 5-fluorodeoxyuridine-resistant Arg50 loop mutants of human thymidylate synthase Cancer Res 61 , 66 6 67 2 ... inoculation loop, and ethanol for flaming 12 Bunsen burner 13 30 and 37 °C incubators 14 30 °C shakers 14 Camps and Loeb Methods Combine 40 µL (5 × 109 cells) competent cells with µL of pHSG5 76 or pECpolI...
  • 361
  • 263
  • 0
  1. Khoa Học Tự Nhiên
  2. Sinh học
telomeres and telomerase, methods and protocols

telomeres and telomerase, methods and protocols
Ngày tải lên : 11/04/2014, 07:12
... 24 polymorhisms for 14 proterminal regions Genomics 36 , 49 2 – 5 06 33 Meltzer, P S., Guan, X Y., and Trent, J M (19 93) Telomere capture stabilizes chromosome breakage Nat Genet 4, 252 – 255 34 ... Cell 43 , 40 5 – 4 13 22 Shippen-Lentz, D and Blackburn, E H (1990) Functional evidence for an RNA template in telomerase Science 269 , 5 46 – 552 23 Blasco, M A., Funk, W., Villeponteau, B., and Greider, ... normal cells Science 279, 34 9 – 35 2 47 Bacchetti, S (19 96) Telomere dynamics and telomerase activity in cell senescence and cancer Cell Dev Biol 7, 31 39 48 Shay, J W and Bacchetti, S (1997) A...
  • 236
  • 344
  • 0
  1. Khoa Học Tự Nhiên
  2. Sinh học
hplc of peptides and proteins, methods and protocols

hplc of peptides and proteins, methods and protocols
Ngày tải lên : 11/04/2014, 09:46
... 2 .4 3. 4 3. 13 2 .6 3 .6 3. 81 3 .6 4 .3 3.75 3. 8 4 .3 4. 21 4 .3 4. 8 4. 76 4. 8–5.2 5 .68 5.0 6. 0 7.20 6. 7–7 .6 7.55 7 .6 8.2 8 .35 8.2–8.7 Anion exchange 4. 75 4. 5–5.0 5 .68 5.0 6. 0 5. 96 5.5 6. 0 6. 46 5.8 6. 4 6. 80 ... Wt ~1 14 .6 14 .6 14. 9 15.0 15.2 15 .3 16. 8 17.0 17 .3 19.5 10.7 11.0 135 ,500 1 43 , 000 66 0,000 168 ,000 48 0,000 120,000 115,700 64 ,000 117,500 129,000 125,700 112,000 1 14 ,30 0 Data from refs and The ... 5. 96 5.5 6. 0 6. 46 5.8 6. 4 6. 80 6. 4 7 .3 7. 76 7 .3 7.7 8. 06 7 .6 8.5 8.52 8.0–8.5 8.88 8 .4 8.8 8 . 64 8.5–9.0 9.50 9.0–9.5 9. 73 9.5–9.8 10 .47 9.8–10 .3 11.12 10 .6 11 .6 a Concentration (mM) Counter-Ion...
  • 395
  • 367
  • 0
  1. Khoa Học Tự Nhiên
  2. Sinh học
mrna processing and metabolism, methods and protocols

mrna processing and metabolism, methods and protocols
Ngày tải lên : 11/04/2014, 09:53
... CCCAACTGAAGGCTAGGCTGTGG PMA1 p, 37 0 PMA1 p, –70 PMA1 cds1, + 168 PMA1 cds1, +3 76 PMA1 cds2, +1010 PMA1 cds2, +1 235 PMA1 cds3, +2018 PMA1 cds3, +2290 PMA1 cds4, +5 84 PMA1 cds4, +807 PMA1 3' UTR top PMA1 3' UTR bottom ... Dev 15, 33 19 33 29 16 Morris, D P., Phatnani, H., and Greenleaf, A L (1999) Phospho-CTD binding and the role of a prolyl isomerase in pre-mRNA 3' end formation J Biol Chem 2 74, 31 ,5 83 31 ,587 17 ... GAAAATATTTGGTATCTTTGCAAGATG GTAAATTTGTATACGTTCATGTAAGTG GAL1 p, –190 GAL1 p, + 54 GAL1 cds1 +42 7 GAL1 cds1 +7 26 GAL1 cds2 +1 039 GAL1 cds2 + 133 1 GAL1 3' UTR +1 7 64 GAL1 3' UTR +2079 GGTAATTAATCAGCGAAGCGATG TGCGCTAGAATTGAACTCAGGTAC...
  • 267
  • 340
  • 0
  1. Khoa Học Tự Nhiên
  2. Sinh học

Xem thêm