novel functional hubs in leukemia

GASTROINTESTINAL ENDOSCOPY pot

GASTROINTESTINAL ENDOSCOPY pot

... 2.2 min, 20 min, 8h Diphenhydramine 1-10 2-6 h 2.4-9.3 h Excretion metabolism Hepatic; excreted in urine Hepatic and intestinal; excreted in urine Hepatic; Excreted in urine Hepatic; excreted in ... standards of a gastroenterology training program (WGO 2007) In drawing up the standards of training the WGO took into consideration the existing training programs in various countries It is noteworthy ... with higher doses in using propofol alone In interpreting the Indiana trial one must take into account that in the study only a small number of patients (200 in total) were included To prevent...

Ngày tải lên: 27/06/2014, 17:20

284 225 0
Getting closer to the customer a challenge for the c suite

Getting closer to the customer a challenge for the c suite

... hadn’t registered it within 24 hours of the original incident.” Instead of admitting defeat, Mr Carroll decided to continue the fight by doing what he does best– singing He composed a song, entitled ... frequently found in organisations today © The Economist Intelligence Unit Limited 2012 Getting closer to the customer A challenge for the C-suite Key findings in this report The key findings from the ... Annabel Symington The research drew on two main initiatives In February 2012 the Economist Intelligence Unit conducted a survey of 798 senior executives worldwide across a range of industries in order...

Ngày tải lên: 04/12/2015, 00:11

30 192 0
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx

Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx

... six grains of snuff as effectual in exciting vomiting, as two of Tartar emetic By many it is preferred in minute doses, as a nauseating medicine Thus administered, it has succeeded in subduing some ... that we meet it in the kitchen, in the dining-room, and in the parlor; in every gathering of men of business; in every party of pleasure; in our halls of legislation; in our courts of justice; and ... has exerted any salutary influence, in restraining young men from falling into those habits which are inevitably followed by much physical suffering, if not by absolute ruin, such a result would...

Ngày tải lên: 17/02/2014, 22:20

29 587 0
Báo cáo hóa học: " Dance-the-Music: an educational platform for the modeling, recognition and audiovisual monitoring of dance steps using spatiotemporal motion templates EURASIP Journal on Advances in Signal Processing 2012," doc

Báo cáo hóa học: " Dance-the-Music: an educational platform for the modeling, recognition and audiovisual monitoring of dance steps using spatiotemporal motion templates EURASIP Journal on Advances in Signal Processing 2012," doc

... temporal beat pattern in the music The inference of the model is conceived as a supervised machine-learning task In supervised learning, the training data consists of pairs of input objects and a ... imitating the basic step model represented in the eight windows placed at the right On top of the figure, one can see the main interface for controlling the display features The main settings involve ... the temporal structure outlined in the music (involving rhythm and timing) The modeling and automatic recognition of dance gestures often involve Hidden Markov Modeling (HMM) [7–10] However, HMM...

Ngày tải lên: 21/06/2014, 19:20

42 325 0
Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt

Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt

... remaining muscles were sutured together over the glenoid fossa and any remaining bony prominences using 4-0 polyglactin (Vicryl suture, Ethicon), and the skin incision was closed in a running ... signaling in superficial neurokinin receptor-expressing neurons in rat spinal cord J Neurosci 2006, 26(6):1833-1843 70 Ramachandran VS, Rogers-Ramachandran D: Synaesthesia in phantom limbs induced ... Employing the use of intra-operative frozen sections would be an effective method of minimizing, if not eliminating, any neural tissue that contains retrograde sprouts However, this raises the interesting...

Ngày tải lên: 10/08/2014, 10:20

10 434 0
Tài liệu DIGITAL LIBRARIES – A CHALLENGE FOR MEDICAL RESEARCH AND EDUCATION ppt

Tài liệu DIGITAL LIBRARIES – A CHALLENGE FOR MEDICAL RESEARCH AND EDUCATION ppt

... certain users need certain enabling technologies to successfully manipulate certain content The notion of a certain community is problematic because the definition in itself does not contain the ... bibliographical but in the future can be used for statistical and rating purposes; Added value in the form of maintaining the object for a longer period of time, making sure it is stable, original and can ... problem solving where the digital library system confirm or deny existing hypotheses In an interesting paper Feng et al.[Feng et al 2005] distinguishes between traditional searching and browsing which...

Ngày tải lên: 24/01/2014, 00:20

10 309 0
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

... and linguistically competent It is increasingly clear that culture influences all aspects of human behavior including its role in defining illness, health, and wellness and in help-seeking and ... reaching identified outcomes, and/or clients feeling inadequate, offended, or humiliated by the educational encounter Incorporating many of the guiding values and prinicples outlined earlier in ... supplies, printing, photography, etc., who is good at writing, doing graphics work, etc Create an understanding that resources come in a variety of ways Guide for Developing Culturally and Linguistically...

Ngày tải lên: 14/02/2014, 13:20

24 525 0
Tài liệu EFFECTIVE POLICIES FOR SMALL BUSINESS: A GUIDE FOR THE POLICY REVIEW PROCESS AND STRATEGIC PLANS FOR MICRO, SMALL AND MEDIUM ENTERPRISE DEVELOPMENT pptx

Tài liệu EFFECTIVE POLICIES FOR SMALL BUSINESS: A GUIDE FOR THE POLICY REVIEW PROCESS AND STRATEGIC PLANS FOR MICRO, SMALL AND MEDIUM ENTERPRISE DEVELOPMENT pptx

... being: ‘committed’ to starting a business; ‘enthusiastic’ about starting a business; ‘could but don’t want to’ start a business; and ‘no interest’ in starting a business Evaluation over time indicates ... ownership of business and industry in general Much of the increase in SME registrations in the EU in the 1990s reflected the downsizing and restructuring of large companies Previously ‘internalised’ ... chain policies Concentrating on the supply chain in a sector is central to harnessing the energies of the private sector, maximising value added and increasing performance in general Value chain...

Ngày tải lên: 18/02/2014, 00:20

110 482 2
A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx

A framework for Enhancing Airlift planning and Excution Capabilities Within the Joint Expeditionary Movement System docx

... against several support options, including deploying maintenance capabilities with units, performing maintenance at FSLs, or performing all maintenance at continental U.S (CONUS) support hubs ... among existing organizations, this option should be accompanied by improvements in existing processes, changes in doctrine, and training enhancements Investment in communications and information ... indicates that systemic problems exist in TDS planning and execution and that a thorough examination of existing processes, doctrine, organization, training, and systems is needed In evaluating...

Ngày tải lên: 15/03/2014, 16:20

151 453 0
Ethics and Professionalism: A Guide for the Physician Assistant ppt

Ethics and Professionalism: A Guide for the Physician Assistant ppt

... Heart from breaking/I shall not live in vain/If I can ease one Life the Aching/Or cool one Pain/Or help one fainting Robin/Unto his Nest again/I shall not live in Vain.” Emily Dickinson, No 919 ... coupled with training in how to accurately recognize emotions in oneself and in others Handling Relationships The art of handling relationships is, in large part, skill in managing our reactions ... compassionate care.24,37 Exemplary clinicians abound in the field of medicine Hard-working, selfless clinicians continue to be an inspiration to anyone who is in training Fourth-year medical student...

Ngày tải lên: 16/03/2014, 04:20

241 488 1
Effects-Based Operations A Grand Challenge for the Analytical Community pot

Effects-Based Operations A Grand Challenge for the Analytical Community pot

... empirical information—including information obtainable from history and from a combination of gaming, manin-the-loop simulation, and experiments in battle laboratories and the field This information ... should include in- depth application of the principles enumerated here in efforts to obtain insights and data from history, training, exercises, and experimentation (both in the “laboratory” and in ... focusing on sobering experiences Strategic Misjudgments Related to Understanding and Influencing Adversaries Some proponents of EBO establish high goals in the cognitive domain, seeking to influence...

Ngày tải lên: 23/03/2014, 00:20

117 299 0
Future R&D Environments A Report for the National Institute of Standards and Technology potx

Future R&D Environments A Report for the National Institute of Standards and Technology potx

... making it possible to imitate nature For example, considerable research is being pursued in examining hydrogen-bonding interactions similar to those in DNA as orienting forces Applications in ... the way cells interpret extracellular signals is more complex than targeting a single gene and involves hierarchical patterns of protein-protein interactions For example, defining a ligand for ... protein-protein interactions in cells that are important in understanding signal transduction, drug delivery, and other processes Biosensors are constructed by labeling two potentially interacting...

Ngày tải lên: 23/03/2014, 01:20

233 408 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... 5¢)3¢ orientation VK1.link VK2.link VK3.link VK4.link VK5.link VK6.link VL1.link VL2.link VL3b.link VL3a.link VL4.link VL5.link VL6.link JH1-2.link JH3.link JH4-5.link JH6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC ... determined in a biosensor of molecular interactions in real time (BIACORE) Table shows the values obtained for the binding kinetic constants The affinity constants of both scFvs were similar, in ... might also be important for binding to the toxin The change of Val to Phe may result in a better interaction in terms of an increased contact area Changes at CDRs and in clone 610A had a synergistic...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx

... aggregation [18] In contrast, we found a single client-binding site in Escherichia coli HtpG, which was localized solely in the N-terminal domain (residues 1–336) of the 624-amino acid protein [17] All ... substitutions in the hydrophobic segment in the C-terminal domain of HSP90a The bacterial two-hybrid system was used to evaluate the binding activity The binding activity of the C-terminal domain (100%) ... and C-terminal domains might be sufficient to maintain the complex under the experimental conditions Bearing in mind the finding that the hybrid formation of the N-terminal and middle domains between...

Ngày tải lên: 23/03/2014, 20:22

9 365 0
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx

... grammatical competence, in addition to being a useful technique for constraining parsing Conclusion Including the D-combinator rules in the CCG rule set lets us capture several linguistic generalizations ... effectively an inert functor In Baldridge’s (2002) system, only proofs involving the ARP and ALP rules produce inert categories In Eisner NF, all instances of B-rules result in inert categories ... therefore be incorporated seamlessly into CCG In the preceding subsection, we encoded Eisner NF with inert slashes In Baldridge’s CTL basis for CCG, inert slashes are represented as functors seeking non-lexical...

Ngày tải lên: 31/03/2014, 00:20

9 360 0
Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

Báo cáo Y học: Conformationally constrained human calcitonin (hCt) analogues reveal a critical role of sequence 17–21 for the oligomerization state and bioactivity of hCt ppt

... assessed from 13 independent experiments to be 12.94% (± 3.59) Specific binding was the difference between total binding (tracer alone) and nonspecific binding In vivo hypocalcemic assay The in vivo hypocalcemic ... being predominantly random coil hCt contained 27% b sheet, the rest consisting mainly of random coil These results indicated an about 50% increase of b sheet contents in 1–4 compared to hCt Since ... the binding studies of and 6; showed a significantly reduced binding affinity (IC50 ¼ 18 nM) as compared to hCt (IC50 ¼ nM), while showed almost no binding Together, the obtained receptor binding...

Ngày tải lên: 31/03/2014, 21:21

12 448 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc

báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc

... (by different or the same individuals) and information is shared, allowing for ongoing self-informing and self-correcting activities External Environment Public mandates Internal Environment University ... goals • Provide guidance in the specification of the curriculum Establish processes for defining, assessing & revising curriculum • Provide structure for the continuing definition, assessment, and ... emerged: hire more faculty, emphasizing those with training in core public health disciplines; and begin the complex academic planning and curriculum development process In 2005, the department of five...

Ngày tải lên: 18/06/2014, 17:20

10 577 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

... Standard curve of GI assay R2 1.00 and a slope of -3.8 was obtained (C) Melting curve of GI standards showing melting point at 90°C in descending order 107 – 101 molecules GI and GII NoV genotypes The ... curve of GII assay R2 1.00 and a slope of -3.7 was obtained (C) Melting curve of GII standards showing melting point at 88°C in descending order × 107 – × 101 molecules described here would be ... panel are shown on the left binding to there respective probes Clinical samples binding to probe GII/4 can be seen on the right of both A and B Biotinylated RT-PCR Biotinylated reverse primers G1NVR...

Ngày tải lên: 18/06/2014, 18:20

8 535 1
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

... Standard curve of GI assay R2 1.00 and a slope of -3.8 was obtained (C) Melting curve of GI standards showing melting point at 90°C in descending order 107 – 101 molecules GI and GII NoV genotypes The ... curve of GII assay R2 1.00 and a slope of -3.7 was obtained (C) Melting curve of GII standards showing melting point at 88°C in descending order × 107 – × 101 molecules described here would be ... panel are shown on the left binding to there respective probes Clinical samples binding to probe GII/4 can be seen on the right of both A and B Biotinylated RT-PCR Biotinylated reverse primers G1NVR...

Ngày tải lên: 20/06/2014, 01:20

8 502 0
Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

... unboxing Như bạn thấy ngược lại với trình boxing Unboxing sau thực Boxing Đây chương trình minh họa trình boxing unboxing: using System; public class Unboxing { public static void Main() { int ... mảng using System; public class UsingForeach { public static int Main() { int[] intArray = {1,2,3,4,5,6,7,8,9,10}; foreach( int item in intArray) { Console.Write("{0} ", item); } Console.ReadLine(); ... public override string ToString() { return string.Format("({0}, {1})", x, y); } } class Test { static void Main() { Point a = new Point(); Point b = new Point(3, 4); double d = Point.Distance(a,...

Ngày tải lên: 28/06/2014, 23:20

103 485 0
w