not containing a finite verb

NON-FINITE VERB -ADVANCED

NON-FINITE VERB -ADVANCED

... ) (what somebody wants in a particular situation not in general): * 'Would you prefer tea or coffee?' 'Coffee, please.' We say 'would prefer to do' (not 'doing'): ... broken 2 As an adjective:(passive meaning ) stolen money a written report 3 The past participle can replace a subject + passive verb just as the present participle can replace subject + active verb: She ... 'doing'): * 'Shall we go by train?' 'Well, I'd prefer to go by car.' (not 'I'd prefer going') * I'd prefer to stay at home tonight rather than...

Ngày tải lên: 20/09/2013, 15:10

5 870 7
Tài liệu Báo cáo khoa học: A peptide containing a novel FPGN CD40-binding sequence enhances adenoviral infection of murine and human dendritic cells doc

Tài liệu Báo cáo khoa học: A peptide containing a novel FPGN CD40-binding sequence enhances adenoviral infection of murine and human dendritic cells doc

... Ferrari, S., Giliani, S., Insalaco, A. , Al-Ghonaium, A. , Soresina, A. R.,Loubser,M.,Avanzini,M .A. ,Marconi,M.,Badolato,R., Ugazio, A. G., Levy, Y., Catalan, N., Durandy, A. , Tbakhi, A. , Notarangelo, ... IgG1 lambda (Sigma) at a concentration 2288 J. L. Richards et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Acknowledgements The authors thank Drs Gail Bishop, Andrea Bottaro, David Gray, Alexandra Livingstone ... peptide may have a use in vaccine delivery or gene therapy, and the ability to use the same CD40-targeting peptide for murine and human applications should provide an important advantage in translation...

Ngày tải lên: 20/02/2014, 11:20

8 458 0
Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx

Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx

... more information in lexical entries and increasing am- biguity so that other ambiguity types also can be disambiguated in a similar way via lexical cate- gory disambiguation. This idea has been ... friend accepted the man who was very impressed, the tagger showed a repair since it initially preferred a past-participle analy- sis for accepted and later it had to reanalyze. This is a limitation ... maintained. Among the different sources of information manipulated by Kim et. al., the so- called elementary structural information is consid- ered as a reasonable and ideal parameter for ad- dition...

Ngày tải lên: 20/02/2014, 11:21

8 446 0
Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

... expand out each of the three cases: (1 3a) homorganic-nasal-cluster ~ labial-nasal labial-obstruent (13b) homorganie-nasal-cluster ~ coronal-nasal coronal-obstruent (13c) homorganic-nasal-cluster ... constraint. Nasal-cluster and place-assimilation are defined as: (1 7a) (setq nasal-cluster-lattice (M. nasal-lattice obstruent-lattice)) (17b) (setq place-assimilation-lattice (M + (M** labial-lattice) ... Network Grammars for Natural Language Analysis, CACM, 13:10, 1970. Z7. Zue, V., and Shattuck-Hufnagel, S., When is a ,/Ts /not a /3V?, ASA, Atlanta, 1980. 97 (3) [dD~hlf_lt) tam] It is...

Ngày tải lên: 21/02/2014, 20:20

7 420 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... (5¢-ACGC GGATCCAG TCATAAACAGCGGTTGC-3¢, Bam HI site un derlined), 87SufI-BamHI-rv (5 ¢-ACGC GGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHA- XbaI+ClaI-rv (5¢-ACTG ATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC- ... a s a template and the primers RRTorA-SacI-fw (5¢-GCGCG GAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCAT GGATCCCGCGCGC TTGATGTAATC-3¢, BamHI site underlined). ... 5B, lane 10). Similarly, steady state analysis did not A B Fig. 4. In vivo analysis of S ufI export in Dtig, DdnaKdnaJ and Dtig DdnaKdnaJ mu tants. S teady state (A) and pulse-chase (B) analysis...

Ngày tải lên: 07/03/2014, 16:20

9 393 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot

... transferase; pink, maltogenic a- amylase; blue, a- amylases from Bacillus and actinomycetes; light blue, a- amylases from fungi and yeast; green, maltotetraohydrolases and maltopentaohydrolase. A ... Reference withdrawn. 75. Takada, M., Nakagawa, Y. & Yamamoto, M. (2003) Biochem- ical and genetic analyses of a novel c-cyclodextrin glucano- transferase from an alkalophilic Bacillus clarkii 7364. ... Ohdan, K., Kuriki, T., Takata, H. & Okada, S. (2000) Cloning of the cyclodextrin glucanotransferase gene from alkalophilic Bacillus sp. A2 – 5a and analysis of the raw starch-binding domain. Appl....

Ngày tải lên: 08/03/2014, 08:20

11 616 0
Capital market bank funding (Not such a) brave new world … docx

Capital market bank funding (Not such a) brave new world … docx

... transparency about the quality and quantity of publicly available information about the cover pool is decisive, because this indicates which financial assets are encumbered as collateral and ... contains strict capital standards for securitised instruments, such as ABS and structured financial products, but not for Pfandbriefe. The capital standards thus make Pfandbriefe more attractive ... ECB. 8 Pfandbriefe that are not placed in the market can be used for example as collateral at central banks or CCPs. 9 At best, a maximum of eight Pfandbrief issues with a total volume of...

Ngày tải lên: 15/03/2014, 10:20

16 365 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

... may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc. There are many words in our language about whose pronunciation the best ... the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that will be most generally approved by ... copy them, placing the accent and diacritical marks in the proper places. Other methods will readily suggest themselves. If the pupils are not already familiar with the diacritical marks they...

Ngày tải lên: 22/03/2014, 16:22

156 470 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot

... PKN, and rhophilin in the rho-binding domain. J. Biol. Chem 271, 13556–13560. 15. Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A. ,Fujita ,A. ,Watanabe,N.,Saito,Y.,Kakizuka ,A. ,Morii,N.& Narumiya, ... Furuyashiki, T., Ishizaki, T., Watanabe, G., Watanabe, N.,Fujisawa,K.,Morii,N.,Madaule,P.&Narumiya,S.(1996) Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, ... PRK2 kinase is a potential effector target of both Rho and Rac GTPases and regulates actin cytoskeletal organization. MolCellBiol.17, 2247–2256. 13. Watanabe, G., Saito, Y., Madaule, P., Ishizaki,...

Ngày tải lên: 23/03/2014, 21:20

9 394 0
Báo cáo khoa học: "Compiling Boostexter Rules into a Finite-state Transducer" potx

Báo cáo khoa học: "Compiling Boostexter Rules into a Finite-state Transducer" potx

... chunking (Abney, 1991; Bangalore and Joshi, 1999), parsing (Roche, 1999; Oflazer, 1999) and machine translation (Vilar et al., 1999; Bangalore and Riccardi, 2000). Finite- state models are attractive ... problems are loosely char- acterized as semantic classification and have been used in many practical applications including call routing and text classification. Most of these problems have been addressed ... Extened Finite State Models of Language. Cambridge University Press. Compiling Boostexter Rules into a Finite- state Transducer Srinivas Bangalore AT&T Labs–Research 180 Park Avenue Florham Park,...

Ngày tải lên: 31/03/2014, 03:20

4 263 0
Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt

Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt

... of a Balas solution v (cf. Section 6); no extensional modelling is necessary. Although our special-purpose Balas adaptation no longer constitutes a general framework that can be fed with each and ... have to turn another 1 to 0 (due to a constraint), or if a 0 cannot be swapped to 1, the potential gain is decremented 446 by a certain cost factor. If the potential gain is exhausted that way, ... memory-based learner TiMBL (Daelemans et al., 2004) is used as a (pairwise) classifier. TiMBL stores all training examples, learns fea- ture weights and classifies test instances accord- ing to the majority...

Ngày tải lên: 31/03/2014, 20:20

9 436 0
Báo cáo khoa học: "Document Classification Using a Finite Mixture Model" pdf

Báo cáo khoa học: "Document Classification Using a Finite Mixture Model" pdf

... Using a Finite Mixture Model Hang Li Kenji Yamanishi C&C Res. Labs., NEC 4-1-1 Miyazaki Miyamae-ku Kawasaki, 216, Japan Email: {lihang,yamanisi} @sbl.cl.nec.co.j p Abstract We propose a ... may individually appear in the category only very rarely; polysemy problem how to determine that a word like 'ball' in a document refers to a 'tennis ball' and not a 'soccer ... document classification. Guthrie et. al. have devised a way suitable to documentation classification. Suppose that there are two categories cl ='tennis' and c2='soccer,' and we...

Ngày tải lên: 31/03/2014, 21:20

9 189 0
Báo cáo khoa học: "Approximating Context-Free Grammars with a Finite-State Calculus" docx

Báo cáo khoa học: "Approximating Context-Free Grammars with a Finite-State Calculus" docx

... grammar. An exam- ples is: S ~ al S S~al A1 S-+anS S-+anAn A~ -+ a~ X A2 + al A2 An -~ al An X-+e A1 -+ a2 Az A1 ~ an A1 A2 -+ a2 X A2 ~ an A2 An -+ a2 A, ~ An ~ an X Here the grammar ... 1996), is faster in some cases, and has the advantage of be- ing open-ended and adaptable. 1 Finite- state approximations Adequate models of human language for syntac- tic analysis and semantic ... be applied to these formalisms too. 2 Finite- state calculus A &apos ;finite- state calculus' or &apos ;finite automata toolkit' is a set of programs for manipulating finite- state automata...

Ngày tải lên: 31/03/2014, 21:20

8 196 0

Bạn có muốn tìm thêm với từ khóa:

w