north atlantic deep water reaches the surface at the

Tài liệu Báo cáo khoa học: Shaped by the environment – adaptation in plants Meeting report based on the presentations at the FEBS Workshop ‘Adaptation Potential in Plants’ 2009 (Vienna, Austria) pdf

Tài liệu Báo cáo khoa học: Shaped by the environment – adaptation in plants Meeting report based on the presentations at the FEBS Workshop ‘Adaptation Potential in Plants’ 2009 (Vienna, Austria) pdf

... genetic variation is the ultimate source of pheno- typic variation within populations, it is the driving force for creating the raw materials on which natural selection can work to cause adaptation. ... relevant species, either in their natural habitats or isolated from natural habi- tats. The genomes of 10 closely related Drosophila spe- cies were, for example, recently sequenced [21]. The value and ... laboratory and natural isolates of the bacterium Escherichia coli from diverse ecological niches, including commensal and pathogenic isolates, has revealed that mutation rates vary between isolates...

Ngày tải lên: 18/02/2014, 11:20

10 666 0
Sculpture of the Exposition Palaces and Courts Descriptive Notes on the Art of the Statuary at the Panama-Pacific International Exposition San Francisco ppt

Sculpture of the Exposition Palaces and Courts Descriptive Notes on the Art of the Statuary at the Panama-Pacific International Exposition San Francisco ppt

... it in the water at the four relatively respective points of the compass, North, South, East and West, are groups representing the Atlantic and the Pacific Oceans and the North and the South ... aquatic composition expressing in exuberant allegory the triumph of Energy, the Lord of the Isthmian Way. It is the central sculptural feature of the South Garden, occupying the great quatrefoil ... conquered the country in the early part of the sixteenth century. The End of the Trail By James Earle Fraser, Sculptor " ;The trail is lost, the path is hid, and winds that blow from out the...

Ngày tải lên: 15/03/2014, 14:20

67 482 0
The Expert at the Card Table: The Classic Treatise on Card Manipulation

The Expert at the Card Table: The Classic Treatise on Card Manipulation

... with the thumb in the usual manner, and then with a swing of the hand towards the player, the card is released by the thumb and slides off the deck over the table in the direction indicated. The ... loves the hazard rather than the stakes. As a matter of fact the principal difference between the professional gambler and the occasional gambler, is that the former is actuated by his love of the ... making the selection as discreetly as possible while gathering up the cards for the deal, or it may be the operation of a much more obscure and apparently impossible feat that of gathering the...

Ngày tải lên: 19/03/2014, 13:04

136 541 4
Establishing a surface water quality monitoring network for the Mekong delta,Viet Nam

Establishing a surface water quality monitoring network for the Mekong delta,Viet Nam

... However, the surface water quality in the MD is still changing in the complicated way due to following: 1.2 Problems related with water Located at the downstream end of the River, the MD will ... and bathing in contaminated waters. Also at serious risk are those who consume fish, shellfish and other aquatic animals and plants that have accumulated pathogens from the water in which they ... aesthetic water pollution problems, dumping or discharge of organic matter into receiving water bodies also creates oxygen deficiency. After being discharged into the water the 2 Surface- water...

Ngày tải lên: 04/11/2013, 20:15

26 578 0
Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

Tài liệu Conditions of the surface water and ground water resources in the rural area of the Mekong Delta, Vietnam pptx

... be expected that the water demand will increase rapidly. Additionally, the impact of waste water on the surface waters will increase. 17 table 5: results of the surface water samples (selected ... important there are seasonal differences as well. The surface water at the study sites An Binh and Hoa An are influenced by leachate water from the irrigation ditches of the rice fields. At both ... Also, data on surface water and ground water quality, climatic data and data on ground water levels was collected and evaluated for the surrounding area. Here, a GIS was set-up, various evaluation-methods...

Ngày tải lên: 16/01/2014, 17:20

17 695 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... sequence F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA R1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC ATH1_pUG36_D GC ACTAGTATGAAAAGAATAAGATCGCTTT ATH1_pUG36_R ... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC ATH1_3633_BH GGATCCTCATTGAGAACAATTTCCTTGA ATH1_395_BH GGATCCATCATGTTCTCATCATCATAATATG ATH1_209_BH GGATCCGTTAAATATAATGCAGTGACGAAGATA ATH1_140_BH GGATCCAAGTCAAACCTTGAGAAAGAACGA mCherry–pSC1_D ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA mCherry–pSC1_R TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC HA_D ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG HA_R...

Ngày tải lên: 18/02/2014, 06:20

15 475 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx

... at Université Pierre et Marie Curie in the framework of prerequisite training of Master “Mathematical Modeling”, part of Master of “Mathematics and Applications”, Centre de Recherches Mathématiques, 4 and ... phase of the response to exponential sine waves) that yields the frequency band over which the pathway can adequately process the input signal. Dynamical stimuli allow the testing of the adaptation ... Alrik, Matthieu [Matthew], Alexan- dre, Joanna, Damien, and Frédéric [Frydsek]). This book is dedicated to the author’s father and grandfathers. 4 Introduction are released from cells of the adrenal...

Ngày tải lên: 05/03/2014, 22:21

999 3,2K 0
IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

... until they had already had their impact on the fisheries. Past Abundance in the North Atlantic The earliest accounts that we have of fish populations in the North Atlantic make it clear that both ... of the North Atlantic investigated in our study compared to the relative abundance 50 and 100 years ago. The question we aim to answer, for the North Atlantic and subsequently the rest of the ... predator in the system—us—there will be less fish of the kind we like to eat. The work and concepts documented herein describe a fascinating adventure. To assess the present status of the North Atlantic s ecosystems,...

Ngày tải lên: 06/03/2014, 18:21

206 577 0
Báo cáo khoa học: "Deep dependencies from context-free statistical parsers: correcting the surface dependency approximation" pptx

Báo cáo khoa học: "Deep dependencies from context-free statistical parsers: correcting the surface dependency approximation" pptx

... ⊗ CAT×TAG×MCAT×MTAG ⊗ CAT×TAG   CAT×HD ⊗ (FIRST/LAST)CAT   (L/RSIS)CAT   DPOS×CAT  PATH   CAT×RCAT  TAG× RCAT  CAT×TAG×RCAT  CAT×RCAT×DPOS  HD×RHD ⊗ CAT×HD×RHD  CAT×DCAT     MHD×HD ... feature is recorded; underscores indi- cate variables that can match any category; and the angle-bracketed parts of the tree fragment, together with an index for the pattern, determine the feature value. 8 4 ... appro- priate operation to the node. Operations may in- volve the insertion of a category at some position among a node’s daughters; the marking of certain nodes as dislocated; or the relocation...

Ngày tải lên: 08/03/2014, 04:22

8 458 0
Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States pot

Poisoning the Well: How the EPA is Ignoring Atrazine Contamination in Surface and Drinking Water in the Central United States pot

... fact that atrazine used in fields eventually ends up in surface water and treated drinking water, the regulation of atrazine under these two statutes is not coordinated. The Dangers of Atrazine ... time the results of surface water and drinking water monitoring required by the EPA across the Midwestern and Southern United States. NRDC obtained these data from the EPA’s Ecological Watershed ... concentrations in these watersheds would be statistically representative of the 1,172 most vulnerable watersheds in the country. Indeed, based on the results of its watershed monitoring program, the EPA...

Ngày tải lên: 15/03/2014, 10:20

4 530 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... between the substrate and the active oxygen species to generate product. Previous data have led to the conclusion that the species responsible for oxygenation of substrate is the diferryl intermediate ... 0 to )0.6 V at 2 mVÆs )1 . The arrow shows the effect of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 l M , respectively). The effect of ventilating the reaction at the highest catalase ... the inactive MMOB tru (data not shown). When the substrates methane or acetonitrile were added to the MMOH/MMOB (1 : 2) complex in the absence of catalase and the electrode was held at a negative...

Ngày tải lên: 17/03/2014, 09:20

6 464 0
w