nk t cell lymphoma nasal type

... impair the ability of the Tax protein to transactivate different promoters [31] Taken together, these data suggest that the TRE-1 element plays an important role in the activation of HTLV-1 gene expression ... considered significant The data were analyzed with Stata statistical software (StataCorp, release 5.0, 1997; Stata, College Station, TX) Results Out of the 256 subjects, the quantitative assay classified ... significantly transactivate HTLV RNA transcription via the viral LTR through its interaction with members of the activating transcription factor/cAMP-responsive element (CRE) binding protein bound to the...

Ngày tải lên: 18/06/2014, 18:20

... directed against T cells, in addition to investigating mechanisms of action of current therapies such as methotrexate Competing interests The authors declare that they have no competing interests ... Feldmann M, et al.: Infliximab and methotrexate in the treatment of rheumatoid arthritis Anti-Tumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group The New England ... (data not shown) This indicates differences in the T- cell epitope specificities between the two strains IL-5 and IL-10 were not detected in the cultures (data not shown) It has been reported that...

Ngày tải lên: 09/08/2014, 10:21

... 5’-TCCTTCTCATCAGCAAGCTGTC-3’ and reverse 5’-GAGGCAGCCCAGGTCCTTGAA-3’ (529 bp fragment); PI3K, forward 5’-CATCACTTCC TCCTGCTCTAT-3’ and reverse 5’-CAGTTGTTGGCAATCTTCTTC-3’ (377 bp fragment); Akt, forward ... individually Statistical Analysis Data were analyzed with SPSS 11.5 software Statistics processing about clinical data were evaluated with c2 test, Spearman’s rank correlation test Statistics processing ... peripheral T cell lymphoma, not otherwise characterized (32 cases), extranodal NK/ T cell lymphoma, nasal type (5 cases), anaplastic large cell lymphoma (2 cases), and angioimmunoblastic T cell lymphoma...

Ngày tải lên: 10/08/2014, 10:21

... patients with PTCL-NOS treated with anthracycline-containing chemotherapy Patients and methods Patients Patients diagnosed with PTCL between January 2000 and December 2009 from Korean institutions ... evaluated for inclusion into the study Patients with a diagnosis of PTCL other than PTCL-NOS, such as anaplastic large cell lymphoma, angioimmunoblastic T- cell lymphoma, enteropathy-associated T- cell ... performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol was approved by the institutional...

Ngày tải lên: 10/08/2014, 21:23

... vincristine, prednisone) His gastric outlet obstruction was supported with total parenteral nutrition (TPN) for a few weeks, after which the patient was able to eat well A repeat PET scan after the ... unusual in that the lymphoma tested positive for EBV, even though it was of T- cell origin, which is only seen in a small minority of patients [12] The initial step in treating PTLD is reduction in ... Monoclonal T- Cell Lymphomas Other Types • Diffuse large B cell lymphoma • Burkitt/Burkitt-like lymphoma • Plasma cell myeloma • Peripheral T cell lymphoma • Large CellAnaplastic • Unspecified • Raretypes...

Ngày tải lên: 11/08/2014, 02:22

... Competing interests The authors declare that they have no competing interests Authors’ contributions OA attended the patient, collected data and wrote the manuscript GC attended the patient and ... affected patients [2] This case shows that angioimmunoblastic lymphoma can present with huge kidneys without nephrotic syndrome This uncommon presentation of this rare disease together with the ... for hepatitis, Rickettsiae and other zoonotic infections PPD (tuberculin) tests were negative (twice) as was an HIV test, and we ruled out parasitic infection The results of a complete panel...

Ngày tải lên: 11/08/2014, 14:21

... status in samples without circulating ATL cells among three HTLV-1seropsitive groups, asymptomatic (healthy), symptomatic carriers with HTLV-1-unrelated disorders and patients with lymphoma type ... symptomatic carriers and patients with lymphoma- type ATL as a control because this type of ATL has no circulating ATL cells A total of 37 samples were seropositive for HTLV-1 and undetectable ... symptomatic carriers unrelated to HTLV-1 and 7(87.5%)/8 patients with lymphoma- type ATL without circulating ATL cells On the other hand, in SBH analysis, no visible aberrant bands were detectable...

Ngày tải lên: 12/08/2014, 04:20

... after transfection or with pUC19 two days after transfection MT-2, total RNA extracted from the HTLV-1-infected cell line MT-2 was used as the positive control; N, total RNA extracted from 29 3T ... complete provirus clone These results suggest that the sequence between 40 nucleotides (nt) and 113 nt at the AatII site downstream from the beginning of the 3' LTR, which constitutes the C-terminal ... epithelial 29 3T cell line RT-PCR of the transfected 29 3T cells with Δ3' LTR and Δ3' LTR BstEII demonstrated that the cells expressed mRNA sequences corresponding to the tax gene However, the cells...

Ngày tải lên: 12/08/2014, 04:21

... substitutions and tested these Rex-1 mutants to see if they retain their ability to function in our quantitative reporter bioassay The Rex-1 mutants were transiently co-transfected into 29 3T cells ... treated as follows First, the protein was subjected to trypsin enzymatic digestion The tryptic peptides that were too large to detect were either digested further with elastase or independently ... [44] This mutation completely abrogated Tax-1 protein expression and function (data not shown) The S-Rex-1 expression construct was transiently transfected into 29 3T cells, and the appropriate...

Ngày tải lên: 12/08/2014, 23:22

Ngày tải lên: 13/08/2014, 01:20

... indirect cellular effects that facilitate the survival of the T- lymphocyte, the natural target for HTLV infection and cellular transformation Methods Cells 29 3T cells and 729 B cell lines were maintained ... 729.HTLV-2Δp28 relative to the β-actin loading control was detected by Western blot and, as expected, Tax-2 was not detected in the 729 negative control cells (Fig 4B) Therefore, as with transient ... significant transcriptional regulatory activity [29-31] suggesting the possibility of distinct or additional functions Together, these findings suggest that p30/p28 facilitates virus and/or infected cell...

Ngày tải lên: 13/08/2014, 05:20

... HTLV-I-infected T cells The results of the present study suggest that lung production of inflammatory cytokines and chemokines by HTLV-I-infected epithelial cells, in addition to that by infiltrating ... A549 cells cocultured with MT-2 cells Thus, consistent with the ability of HTLV-I to induce transcription of several cellular genes, infection of lung epithelial cells with HTLV-I increased the ... supernatant of the MMC-treated MT-2 cells, the number of which http://www.retrovirology.com/content/5/1/86 corresponds to that used for coculturing, was less than 25 pg/ml These results argue against the...

Ngày tải lên: 13/08/2014, 05:21

... 5'-gaaagaacgagcccgattaTTCAAGAGAtaatcgggctcgttctttcTTTTT-3' for hDlg1-1, 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' for hDlg1-3, 5'gagtggatgccacgacggtttGTGTGCTGTCCaaatcgtcgtggtattcactcTTTTT-3' ... respectively The sequences of these oligonucleotides are 5'-ggatggcgagctttaggttggGTGTGCTGTCCccaatctgaagcttgccatccTTTTT-3' for Dlg1-1, 5'ggatgtttaggagtataagttGTGTGCTGTCCaacttatgctcctgaatatccTTTTT-3' for ... CAT, 5'-ggcctttcactgctcctgcgaGTGTGCTGTCCtcgtaggagtagtgaaaggccTTTTT-3' for LUC, and 5'gcctttcactactcctacgTTCAAGAGAcgtaggagtagtgaaaggcTTTTT-3' for Rluc The oligonucleotides Dlg1-1, Dlg1-3, CAT,...

Ngày tải lên: 13/08/2014, 09:20

... a growth promoting activity in T- cells, thus suggesting that this growth promoting activity of Tax2 contributes to HTLV-2-mediated T- cell transformation Since at least two functions, apoptosis ... resistance to CsA in Tax2-transformed CTLL-2 cells In contrast to Tax2, the cell growth of Tax1-transformed cells was little affected by CsA This finding is also consistent with the result that Tax1 ... CsA-mediated growth inhibition These results show that the activation of NFAT by Tax2 stimulates the cell growth of some Tax2-transformed cells, but not Tax1-transformed ones A real-time polymerase...

Ngày tải lên: 13/08/2014, 09:20

... HeLa cells In contrast to untransfected cells, quiescent cells transfected with pEGFP-HBZ-SP1 failed to progress through the G1/S transition when they were stimulated by serum to enter the cell ... combination with other transcription factors [11] The production of IL-2 by activated T cells is critical for T- cell proliferation and differentiation, and the development of T- cell- dependent immune ... on its intracellular mobility, we decided to perform FRAP analysis with EGFP fused to the mutant HBZ-SP1∆ZIP Interestingly, compared with the wild type, the mutant showed a different pattern...

Ngày tải lên: 13/08/2014, 09:20

... suggests that the CTLs in HAM/TSP cannot control the number of infected cells One explanation for this is that the CTLs in HAM/TSP patients show less efficient cytolytic activity toward infected cells, ... leukemic cells isolated from ATL patients, about 60% of cases not express the tax gene transcript Interestingly, ATL cells with genetic changes of the tax gene expressed its transcripts, suggesting that ... sequences, the oncogenic potential of Tax1 (HTLV-I Tax) is more prominent than that of Tax2 (HTLVII Tax) The most striking difference is that Tax2 lacks the binding motif at C-terminal end to PDZ...

Ngày tải lên: 13/08/2014, 09:21

... Using this method, we demonstrated that APOBEC3G suppressed the infectivity of HTLV-1 Interestingly, not only APOBEC3G but also its inactive mutants inhibited the infectivity of HTLV-1 Taken together ... MT-2 cells inhibited the infectivity of the virus and that it might be linked to very low infectious titers of cell free HTLV-1 viruses Taken together, our findings suggest that APOBEC3G might ... amplified with the following primer pairs:op32.1(ATAGTCGACCTGTTTCGCCTTCTCAGCCC) and op-32.3(TATCTCGAGGAAGCTGTGCTTGACGG) The PCR products were cloned into pT7-Blue (Novagen, Darmstadt, Germany) and the...

Ngày tải lên: 13/08/2014, 09:21

... from that in DNAPKcs +/+ cells, with or without transfect with Tax plasmid ** indicates significantly different value (P < 0.01, G test) from that in DNAPKcs +/+ cells without transfection with Tax ... activity in the genetically altered cells Once induced, such telomerase activity could endow the cells with the capacity to proliferate indefinitely, and this event could represent a first step towards ... interactors with Ku We report here that cells genetically knocked out for Ku80 are refractory to the induction by Tax of MN and DIG-dUTP incorporation Interestingly, in cells intact for Ku80, Tax...

Ngày tải lên: 13/08/2014, 09:21

... transfection (Figure 3A) These results indicate that Tax∆C still has IL-2-independent growth inducing activity in CTLL-2 cells, but the activity is much less than that of Tax1 Both Tax2B and Tax2B+C ... of Rat-1/Tax1 cells were greater than those of Rat1/Tax2B cells, but the presence of Tax1 PBM was only correlated with the number but not the colony size [33] These results suggest that the Tax1 ... account for cell death of CTLL2/Tax∆C cells in the absence of IL-2, since Tax∆C has equivalent NF-κB activity to Tax1 [36] Taken together, the present results suggest that Tax1 PBM cooperates with...

Ngày tải lên: 13/08/2014, 09:21