δ t cell therapy in the setting of hematopoietic stem cell transplantation

Starting ARVs in the setting of Opportunistic Infections pptx

Starting ARVs in the setting of Opportunistic Infections pptx

... Multifocal Lymphadenopathy (PML) Starting ARVs in the setting of an active Opportunistic Infection In other OIs, ARV therapy can exacerbate the condition with IRS In these infections ARV therapy ... in Vietnam • Cite the recommendation of the MOH of the use of NVP with a RIF containing TB therapy • Cite the best time and clinical conditions that a patient with a treated OI can be started on ... Treatment of HIV/AIDS, Ministry of Health, Vietnam March, 2005 16 Starting ARVs in the setting of an active Opportunistic Infection Tuberculosis When should we start therapy? Antiretroviral Therapy...

Ngày tải lên: 01/04/2014, 12:20

40 384 0
gene therapy in the treatment of cancer

gene therapy in the treatment of cancer

... against the tumor and not simply targeting or killing the transfected cells alone This antitumor effect has mostly been attributed to the activation and expansion of existing antitumor immune cells ... co-injected with irradiated wild-type or modified tumor cells to boost the immune response at the site of injection Likewise, the administration of cytokine secreting cells to the tumor bed through intratumor ... limit the need of antigen transfer from the tumor cell to the antigen presenting cell In this case, tumor cell recognition by the innate immune system would not be necessary for the induction of...

Ngày tải lên: 10/04/2014, 22:11

28 454 0
Báo cáo khoa học: "Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy" ppt

Báo cáo khoa học: "Intraoperative radiation therapy in the treatment of early-stage breast cancer utilizing xoft axxent electronic brachytherapy" ppt

... without Results The radiation oncologist then broke scrub, attached the XB controller to the catheter, and inserted the radiation source into the balloon The radiation therapy was then Figure ... to the surrounding breast tissue An intraoperative ultrasound was then performed to evaluate the balloon-to-skin distance and the degree of air and/or fluid in the breast tissue surrounding the ... small incision in the lateral breast and inflated with exactly 40 cc of saline (Figure 1) The conformity of the CED to the surrounding breast tissue was then evaluated under direct visualization...

Ngày tải lên: 09/08/2014, 04:21

6 499 0
Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf

Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf

... that they have no competing interests Authors' contributions PSG participated in the treatment of the patient, collection of case details, literature search and drafted the manuscript The author ... noted after cycles of chemotherapy (Figure 3) We then opted to treat her palliatively with electron beam radiotherapy An irregular electron cut-out was used to define the treatment area A single ... underlying bone Extensive subcentimetre enhancing lymphadenopathy was noted in the anterior and posterior triangles of the http://www.wjso.com/content/7/1/99 neck with the largest noted in the right...

Ngày tải lên: 09/08/2014, 04:21

4 243 0
Báo cáo y học: "Outcomes of highly active antiretroviral therapy in the context of universal access to healthcare: the U.S. Military HIV Natural History Study" ppt

Báo cáo y học: "Outcomes of highly active antiretroviral therapy in the context of universal access to healthcare: the U.S. Military HIV Natural History Study" ppt

... regimen type by year of HAART initiation with duration of HIV infection prior to HAART start for seroconverters (B) Therapy changes over time The declining percentage of patients remaining on the ... optimizing HIV treatment outcomes Competing interests The authors declare that they have no competing interests Authors' contributions The following authors were involved in study conception and design: ... (HCV) coinfection was defined as having at least one positive HCV antibody test ARV use referred to any antiretroviral therapy not meeting the NHS definition of HAART [17] HAART initiation was the...

Ngày tải lên: 10/08/2014, 05:21

10 611 0
báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx

báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx

... presented without evidence of existing physical or emotional distress At her first presentation, she arrived at the emergency department with the onset of aphasia in the setting of hypertensive ... hyperdynamic contraction of the LV basal segments with a relative stunning, or ballooning, of the LV apical portion due to saturation of the adrenoreceptors in that distribution [2] Therefore, there appears ... has been increasingly recognized in the literature, with a recurrence rate of 5% to 10% worldwide [2,4,5] Additionally, the development of TTC in the setting of fleeting neurological symptoms such...

Ngày tải lên: 10/08/2014, 23:20

4 357 0
Báo cáo y học: "Bench-to-bedside review: Hyperinsulinaemia/euglycaemia therapy in the management of overdose of calcium-channel blockers" ppt

Báo cáo y học: "Bench-to-bedside review: Hyperinsulinaemia/euglycaemia therapy in the management of overdose of calcium-channel blockers" ppt

... increasing the inotropic effect of insulin [21,24] Recommendations for the use of HIET in CCB poisoning Although there is wide variation in insulin dosing in the cases reporting the use of HIET in CCB ... verapamil toxicity, HIET increases myocardial contractility, but this effect does not seem to be related to an increase in glucose transport Whether these effects can be extrapolated to the toxicity of ... hour after ingesting amlodipine tablets Conventional therapies failed to improve haemodynamic condition so that insulin infusion at the same rate was started Although the patient was non-diabetic,...

Ngày tải lên: 12/08/2014, 23:23

6 267 0
Báo cáo khoa học: "Diagnosis of left ventricular diastolic dysfunction in the setting of acute changes in loading conditions" pdf

Báo cáo khoa học: "Diagnosis of left ventricular diastolic dysfunction in the setting of acute changes in loading conditions" pdf

... 120°) with multiplane TEE Cardiac index was obtained by measuring the velocity-time integral of aortic Doppler tracings and the diameter of the LV outflow tract [20] In ICU patients, systemic vascular ... placed through the centre of the mitral flow and aligned in the direction of the inflow jet Propagation velocity of LV inflow at early diastole (Vp) was measured as the slope of the first aliasing ... variations were apparently unaffected by LV systolic function Competing interests The authors declare that they have no competing interests Authors' contributions PV, JCA and HG contributed to the...

Ngày tải lên: 13/08/2014, 03:20

9 255 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot

Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot

... concentration was 103 (8) g/L After inflation of the intra-abdominal balloon to the target IAP, the IAP remained constant over the five-minute stabilising period The resulting level of IAP at the time ... shown to be useful in titrating the level of PEEP in the setting of acute respiratory distress syndrome [38] In the setting of IAH, trans-pulmonary pressures have been recommended not only to help ... PEEP taken before and during the randomized protocol An adjustment of the values according to the weight of the individual animal did not alter the findings, therefore absolute values are given The...

Ngày tải lên: 13/08/2014, 21:20

11 406 0
Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

Asymmetric cell division in the regulation of neural stem cell self renewel in drosophila melanogaster

... This results in two Introduction daughter cells that are distinct at birth The neural stem cells in the developing central nervous system (CNS) of Drosophila adopt this intrinsic regulation of ... on the asymmetric localization of cell fate determinants and the proper alignment of the mitotic spindle to ensure that cell fate determinants are inherited by only one of the two daughter cells ... daughter cells of distinct cell fates and/or sizes The latter is the one of the most important aspect of stem cell biology because it is through repeated self-renewing asymmetric division that stem...

Ngày tải lên: 11/09/2015, 14:32

150 284 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2

... Nanog This observation indicates that Lefty2 is indeed functionally important for the maintenance of the ES cell state across species The high homology between the Lefty proteins, together with their ... and mature forms, the V5 tag has to be incorporated at the C terminus and not the N terminus There is also the possibility that tagging at the N-terminus will also disrupt secretion signals Transfection ... specificity-that is, they may cause off target effects (Moffat and Sabatini, 2006) Up to this point, consistent results obtained using two Lefty2 shRNAs targeting different regions of the Lefty2 transcript...

Ngày tải lên: 11/09/2015, 16:02

117 415 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3

... addressed Interestingly, it was found that Nodal signaling is able to arbitrate at least three distinct fate decisions in ES cells Perturbation of endogenous signaling in ES cells leads to their exit ... Conclusion The first chapter of this thesis summarizes the current state of knowledge regarding what constitutes the fundamental mechanics governing ES cell self-renewal Much is left to be learnt The ... to verify if the mechanism via which graded Nodal signaling translates into different cell fates is indeed as such In conclusion, the data presented in this thesis lead to the establishment of...

Ngày tải lên: 11/09/2015, 16:02

4 185 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4

... GATCCCCGAACTATTCTTGCTTACAAttcaagagaTTGTAAGCAAGAATAGTTCTTTTTA Antisense shRNA AGCTTAAAAAGAACTATTCTTGCTTACAAtctcttgaaTTGTAAGCAAGAATAGTTCGGG Lefty2 shRNAs shRNA1 sense GATCCCCGTGAGCTTGTCCTAACTTAttcaagagaTAAGTTAGGACAAGCTCACTTTTTA ... AGCTTAAAAAGACAAATGCTTACTGACAAtctcttgaaTTGTCAGTAAGCATTTGTCGGG shRNA4 sense GATCCCCGTCAAGTTGGGGTAATCATttcaagagaATGATTACCCCAACTTGACTTTTTA shRNA4 antisense AGCTTAAAAAGTCAAGTTGGGGTAATCATtctcttgaaATGATTACCCCAACTTGACGGG ... GATCCCCGTAATGAGCTTAGAAATGTttcaagagaACATTTCTAAGCTCATTACTTTTTA shRNA2 antisense AGCTTAAAAAGTAATGAGCTTAGAAATGTtctcttgaaACATTTCTAAGCTCATTACGGG shRNA3 sense GATCCCCGACAAATGCTTACTGACAAttcaagagaTTGTCAGTAAGCATTTGTCTTTTTA shRNA3 antisense...

Ngày tải lên: 11/09/2015, 16:02

24 298 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5

... Y., Schmitt, J., et al (2005) Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state Stem Cells 23, 166-185 Wieduwilt Matthew J., ... dissection of nodal function in patterning the mouse embryo Development 128, 1831-1843 187 Lu, C C., and Robertson, E J (2004) Multiple roles for Nodal in the epiblast of the mouse embryo in the establishment ... Katsuki, M., Heike, T. , and Yokota, T (1999) STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells Embo J 18, 4261-4269 Mee, P J., O'Brien, C M., Thomson,...

Ngày tải lên: 11/09/2015, 16:02

13 229 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... regulators of ES cell fate These factors are at the top of the hierarchy of the ES cell regulatory network and they keep ES cells undifferentiated by either the activation of target genes that encodes ... recombinant ActRIB, ActRIIB and Cripto, thereby strengthening the idea that intact Nodal/Activin signaling is important in maintaining pluripotent human ES cells Data gathered by several other groups ... inhibitor of ALK4/5/7, the receptors mediating Nodal signals and it globally inhibits Nodal signaling Interestingly, they found that the OCT3/4 compartment is maintained in the controls, while the...

Ngày tải lên: 11/09/2015, 16:02

41 312 0
Appendix  identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency

... CGGTTCTCATGCTCTACTCCAACCG GGCTTCTGTCTGGCAAATGATG E-Cadherin CGGATGGTCTTTGTTCTGGTTATCCG TGACGCAGCTCAAGAATCTCTCA Pdgfr CGGCCTCTGTTCTCTACACTGCCG CCCTCTGGGAGACCTTCATCAG Foxh1 CAGCACTAGCAGGGACTTGATGCTG ... GGACAGGTACGAGTGGCAGT Eomesodermin CCTGGTGGTGTTTTGTTGTG TTTAATAGCACCGGGCACTC E-Cadherin CGGATGGTCTTTGTTCTGGTTATCCG TGACGCAGCTCAAGAATCTCTCA BMP4 CGTGTTCACCTCCACCAGACACG CCTTCTGCGGGTCAAGGTATG 200 ... CCCCTCTTCCGTCCTCTTAC CTGCGAGTGGTCACACTGAT Errb TTTCTGGAACCCATGGAGAG AGCCAGCACCTCCTTCTACA Cdh3 GCCAGGACTCTGAAGTTTGC CAAGTTCAAGCCCTGAGAGG Fgf5 ACTCCATGCAAGTGCCAAAT CACTCTCGGCCTGTCTTTTC Ngn1 GGAGTCGTCGCGTCAAAG...

Ngày tải lên: 11/09/2015, 16:03

12 183 0
báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx

báo cáo hóa học:" Ovarian cancer plasticity and epigenomics in the acquisition of a stem-like phenotype" pptx

... similar to those in the human disease in their histopathology and cell architecture Further, even on serial transplantation, cells of both clones continued to establish tumors Taken together, the ... nestin, B-lymphoma MMLV insertion region (Bmi-1), stem cell factor (SCF-1) and Notch1, in line with the accepted stem -cell phenotype [7,8] The first report on the identification of stem cells in ... cells [135] Such therapy may therefore extended to targeting against cancer stem cells One potential drawback of epigenetic therapy is the possibility that these agents can inhibit or reverse normal...

Ngày tải lên: 20/06/2014, 07:20

11 556 0
Báo cáo sinh học: " Risk factors in the development of stem cell therapy" pdf

Báo cáo sinh học: " Risk factors in the development of stem cell therapy" pdf

... extrinsic risk factors (Table 2), such as the site of administration (i.e the local environment of the stem cell in the recipient) and the need for in vitro culturing The manipulation of the cells ... Most likely the observed effect depends on the nature of the cancer cells, the Page of 14 characteristics of the used MSC, on the integrity of the immune system and on the timing and site of injection ... possibility is the engraftment of the stem cells at these distant or non-target sites As noted earlier the local environment in which the stem cell resides in the recipient may influence the biological...

Ngày tải lên: 18/06/2014, 19:20

14 582 0
Báo cáo khoa học: " Role of p53 mutation in the effect of boron neutron capture therapy on oral squamous cell carcinoma" ppsx

Báo cáo khoa học: " Role of p53 mutation in the effect of boron neutron capture therapy on oral squamous cell carcinoma" ppsx

... applicable to oral SCCs with mutated p53 to promote the efficiency of BNCT Conflict of interests The authors declare that they have no competing interests Authors' contributions YF carried out the experiments ... phase cells at h after BNCT; rather, they decreased slightly (Figure 3) At 12 h after BNCT, the proportion of cells in the G2/M phase was increased to 40%, indicating arrest at the G2/M checkpoint ... Kobayashi T, Kinashi Y, Takagaki M, Ohnishi T: Impact of the p53 status of the tumor cells on the effect of reactor neutron beam irradiation, with emphasis on the response of intratumor quiescent cells...

Ngày tải lên: 09/08/2014, 10:20

8 288 0
w