next and enter a suitable title for the web pl sql application use the startup page tit
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
Ngày tải lên :
18/02/2014, 02:20
... education are weak (they generally are not temporally close and not show explicit payback), and the exchanges in law may be temporally close and explicit but generally are based on coercion and are ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.")...
- 14
- 780
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
Ngày tải lên :
20/06/2014, 08:20
... settings[25-27] and may be associated with favorable clinical and virologic outcomes in patients with both TB and HIV disease in need of treatA Common TB and HIV Paradigm An Alternative TB and HIV Paradigm ... highlight the technical, programmatic, staffing and scale-up challenges that remain and demonstrate that although broad program principles of TB/HIV collaboration and integration are essential, specific ... collaboration and integration and their relevance to the specific setting These models may range from maintenance of separate programs and services with enhanced communication and referral mechanisms...
- 5
- 469
- 0
fardoust et al (eds.) - postcrisis growth and development; a development agenda for the g-20 (wb, 2011)
Ngày tải lên :
01/11/2014, 18:12
... Multipolar growth and rebalancing Trade and aid for trade A Development Agenda for the G-20 for strong, sustainable, and balanced growth Agriculture and food security Finance and access to finance ... international economic analysis at the Central Planning Bureau in the Netherlands He has been a researcher at the University of Lodz in Poland and at the Netherlands Economic Institute He holds a ... Academy, and worked as a consultant for the World Bank and the Asian Development Bank Institute He also served as an advisor for the Presidential Committee on Northeast Asia He received a BAS...
- 588
- 886
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc
Ngày tải lên :
11/08/2014, 23:22
... implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone augmentation around the dental implants ... load-bearing capacity for implants, whereas the use of vertical alveolar grafting for augmentation without implant Orthoalveolar form is the concept for optimal restauration of the edentulous alveolar ... after osteotomy and the hard palate remains pedicled on the nasal septum and vomer [3,19-24] This technique is indicated in cases with flat palatal vault as the hard palate is not relocated and...
- 7
- 375
- 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
Ngày tải lên :
26/10/2012, 09:48
... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... treatment for many years, there are aggressive forms with rapid growth and early metastatic spreading The current therapeutic options in the treatment of PCa are: i) Radical excision of prostate and ... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika...
- 10
- 408
- 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
Ngày tải lên :
03/04/2013, 21:06
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at any time of the day they wanted Similarly to the tasting sessions, As the final task in the ... The pleasantness of the heightened aroma sample increased during the home -use, while the pleasantness of the regular aroma sample remained virtually unchanged (interaction of aroma and day, Fð2;...
- 10
- 599
- 1
Tài liệu Infrastructure Protection and Security Service Integration Design for the Next Generation WAN Edge v2.0 pptx
Ngày tải lên :
24/01/2014, 10:20
... ! ! AAA Authentication commands: (request authentication via ! tacacs+ for both login and for enable level: aaa authentication login default group tacacs+ local enable aaa authentication enable ... tacacs-group host 10.59.138.11 key cisco aaa-server TACACS+ protocol tacacs+ ! ! AAA Authentication commands: (request authentication via ! tacacs+ for both login and for enable level: aaa authentication ... tacacs+ aaa accounting commands default start-stop group tacacs+ aaa accounting commands 15 default start-stop group tacacs+ aaa session-id common ! ! *Note – In the aaa accounting commands you...
- 184
- 746
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
Ngày tải lên :
14/02/2014, 13:20
... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local, regional, national ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a...
- 22
- 703
- 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
Ngày tải lên :
18/02/2014, 01:20
... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... mechanisms for collecting, analyzing, and disseminating information about the current and future markets for accounting professionals and accounting faculty Rational planning requires accurate and current...
- 140
- 391
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
Ngày tải lên :
15/03/2014, 10:20
... included in the analysis are: Austria, Belgium, Finland, France, Germany, Greece, Ireland, Italy, the Netherlands, Portugal and Spain.14 Data are observed at quarterly frequency and cover the period ... between GDP and loan growth, on the one hand, and GPD growth and changes in credit standards, on the other hand Results, which are reported in Table 3, panels A and B, suggest a signi…cant and positive ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3,...
- 30
- 911
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
Ngày tải lên :
28/03/2014, 15:20
... suitable for a practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated that in the surf zone, the time scale ... dissipated when a new wave arrives and breaks. Thus, the time variation of TKE is relatively small, and the combination of wave‐induced flow and undertow may transport TKE and suspended ... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ...
- 11
- 460
- 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot
Ngày tải lên :
30/03/2014, 11:20
... polymerization The Z mutation of a1 -antitrypsin is located, not in the shutter domain, but at the head of strand and the base of the reactive centre loop The mutation forces open the gap between strands ... molecule and b-sheet A of another [17,22,23,51,52] The molecular pathology that underlies this conformational transition is now well defined and has been used as a paradigm for other diseases that result ... and of b-sheet A to allow partial loop insertion and a patent lower b-sheet A that can act as a receptor for the loop of another molecule and hence form polymers [42,51] This patent b-sheet A...
- 13
- 494
- 0
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx
Ngày tải lên :
31/03/2014, 00:20
... Combinatory Categorial Grammar In Proceedings of EMNLP-2006 Mark Steedman and Jason Baldridge To Appear Combinatory Categorial Grammar In Borsley and Börjars (Borsley and Börjars, To Appear) Mark ... constituents simply follow from the associativity added by the B and T rules For example, given the category assignments in (6) and the abbreviations in (7), (4) is analyzed as in (8) and (9) Each ... abbreviated as 2↓ and ♦): Note that the diamond operator used here is a syntactic operator, rather than a semantic operator as used in (16) above The unary modalities used in CTL describe accessibility...
- 9
- 360
- 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities
Ngày tải lên :
31/05/2014, 01:37
... ventilation may be required ANALYTICAL BALANCES Analytical balances are among the prima donnas of the laboratory, requiring separate and unequal treatment They refuse to cooperate if there is the ... hiking As a rule, analytical balances are placed on separate tables, which should be large enough to also hold a desiccator for samples and the operator's notebook The table must be as stable as the ... was installed against a wall and the hot air was drawn off overhead The heat radiating from 12 flasks and heaters, however, made the workers on the other side ofthe narrow room very uncomfortable...
- 173
- 561
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
Ngày tải lên :
18/06/2014, 15:20
... Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation ... with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone-marrow mononucleated cells used in cardiac regeneration Materials and methods ... collected from patients immediately after an acute myocardial infarction (AMI) subjected to standard pharmacological therapy Cell Characterization For the immunophenotype, bone marrow and BM-MNC cells...
- 9
- 773
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic...
- 12
- 573
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
Ngày tải lên :
18/06/2014, 22:20
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (60aa) AAD24564 (60aa) AAD24565 (60aa) AAC26682 (161aa) AAC26681 (161aa) AAD30140 (59aa) AAC55649 (60aa) AAC55650 (59aa) AAC55651 (59aa) AAC26684 (161aa) AAC55656 (59aa) AAC55657 (60aa) [36] [8] [37] ... AAC59454 (156aa) AAC55645 (55aa) CAB61753 (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B...
- 24
- 604
- 0
báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx
Ngày tải lên :
19/06/2014, 22:20
... in large part by the ALS Association; the Oklahoma Center for the Advancement of Science and Technology (HR02149RS); and the National Institutes of Health (AG20783, NS044154) We thank the Oklahoma ... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... dilution of the labeled samples) Curiously, no major protein carbonylation band assignable to SOD1 was found in any G9 3A- SOD1 astrocyte lysates whereas a major carbonylated protein identifiable as SOD1...
- 9
- 436
- 0