national evaluation authority and ccra signa tory that issues cc certificates and recognizes those issued by other national evaluation authorities
AN IMPACT EVALUATION OF EDUCATION, HEALTH, AND WATER SUPPLY INVESTMENTS BY THE BOLIVIAN SOCIAL INVESTMENT FUND pptx
Ngày tải lên :
22/03/2014, 15:20
... Kremer 1995), health (Alderman and Lavy 1996, Lavy and others 1996, Mwabu and others 1993), and drinking water (Brockerhoff and Derose 1996, Lee and others 1997) The main conclusions of the study ... are both baseline and follow-up data and an experimental evaluation design, adding robustness to the results not found in other impact evaluations.3 II Evaluation Design Impact evaluations seek ... Demographic and Health Surveys (which cover a period roughly coinciding with that covered by the baseline and follow-up surveys of the sif evaluation) and rural population estimates from the National...
- 34
- 458
- 0
Roles, authority and involvement of the management accounting function: a multiple case-study perspective ppt
Ngày tải lên :
23/03/2014, 03:20
... carried out by management accountants as being “simultaneously both influenced by and influencing its context formed by its relations to and with others in the firm” (Mouritsen, 1996: 299) and the ... Accountants in Britain and Germany' Management Accounting, pp 42-43 Ahrens, T., and Chapman, C.S (2000) 'Occupational identity of Management Accountants in Britain and Germany' The European Accounting ... each other We understand role by simply observing interactions and activities Understanding the role of a social group, therefore, requires us to study interactions within this group and with other...
- 52
- 394
- 0
political authority and obligation in aristotle may 2005
Ngày tải lên :
11/06/2014, 05:53
... and fact and thus that he locates his ethical and political theory in the right direction of fit between mind and world I shall argue that Aristotle's conception of well-being is accompanied by ... Aristotelian scholarship by arguing that Aristotle's texts accommodate the concepts of political authority and obligation Since the standard view of Aristotelian scholarship is that Aristotle does ... group and the existence of authority tend to go together; and, given the (moral) correlativity between authority and obligation, and the normal factual conditions of a group's existence and coordinated...
- 313
- 364
- 0
Báo cáo khoa học: "Comparative evaluation of phenobarbital-induced CYP3A and CYP2H1 gene expression by quantitative RT-PCR in Bantam, Bantamized White Leghorn and White Leghorn chicks" ppsx
Ngày tải lên :
07/08/2014, 18:21
... ni detcudnoc saw RCP ]71[ ’3 AGAAAGAACCCATACCTCAG '5-)R( nitca-β dna ’3 CAACCGAAACCCCAAGTCCC '5-)F( nitca-β ,'3 TTA CTATCAGTTACGGGTC '5-)R( 1H2PYC ,'3 CTCCTTCT CTACAGTTCACAG '5-)F( 1H2PYC ,'3 ... ihsigeN ,J rehtnyG ,R erooM ,P iksokaknoH 21 191-971 ,8 ,9891 AND seneg tnereffid morf debircsnart sANRm 054P owt fo noitaluger :ANDc 054P emorhcotyc elbicudni latibrabonehp nekcihc a fo ecneuqeS ... eht sa tes saw snoitidnoc gnilcycomrehT lm 52 fo emulov lanif eht ekam ot ebut hcae ni dedda saw ANDc fo elpmas lm eerhT ebut RCP hcae ni seititnauq lm 22 ni detouqila dna deraperp saw selpmas...
- 7
- 291
- 0
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot
Ngày tải lên :
09/08/2014, 07:20
... blood samples collected and stored at 1, 2, and years after diagnosis For this study we used all samples that were still available from the cohort described and those samples that had never been ... each biomarker were, respectively: for C2C, 10– 17% and 14%; for C1,2C, 5–14% and 13%; for CS846epitope, 4–12% and 12%; and for CPII, 11–18% and 16% The interassay coefficients of variance for ... (C1,2C and C2C), but also the turnover and synthesis (CS846-epitope and CPII, respectively) of cartilage Interestingly, it was the biomarkers for degradation of collagen (C2C and C1,2C) and turnover...
- 9
- 525
- 0
An investigation into correlation between discourse markers usage frequency and argumentative writing skills by students at Business English Department, National Economics University
Ngày tải lên :
10/08/2015, 19:50
... than those of the other discourse markers These results are in line with those of other studies showing that Elaborative markers are those frequently used cohesive devices This might imply that ... finished the two exams, I collected and analyzed errors they committed in those papers The errors then were identified and categorized and the most typical and common errors were presented In ... gathering vocabulary and ideas for a topic, brainstorming and outlining, writing, and editing This course aims at equipping students with fundamental understanding of the essay first, and then supplying...
- 12
- 388
- 1
Evaluation of manning’s coefficient of ferrocement trapezoidal and semicircle canals strengthened by CFRP sheets
Ngày tải lên :
09/09/2015, 10:06
... supported and linked at the joints by (epoxy material) After that, the model fixed straight and horizontal after it was given a zero slope via level device And water is supplied to canal by recirculation ... wire mesh, and the steel template for trapezoidal canal as shown in Figures and for semicircular canal Figure Canal dimensions and steel mold for trapezoidal canal Figure Canal dimensions and steel ... International Journal of Energy and Environment (IJEE), Volume 6, Issue 5, 2015, pp.461-470 Scope of work and construction of ferrocement canals The experiments have been conducted laboratory...
- 10
- 294
- 2
THE NITRATE NITROGEN POLLUTION AND THE NITROGEN REMOVAL BY PADDY FIELD IN AGRICULTURAL AREA
Ngày tải lên :
05/09/2013, 09:08
... Journal of Water and Environment Technology, Vol.3, No.2, 2005 fields and forests on a plateau and a wetland which includes a paddy field in the lowlands Initial investigation showed that certain ... the upland is the type that discharges loads, it is understood that the amount of load decreases as it passes through the lowlands A wetland has a natural purification function for nitrogen and ... non-vegetation plot is a test plot that had all vegetation removed by hands 0.34 0.10 Forest 33.7ha -0.24 Rain 0.21 0.58 Upland Field20.7ha 2.68 2.84 Rain/Irrigation 0.12 Wetland 9.7ha -0.58 +2.47 0.03...
- 4
- 489
- 0
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions
Ngày tải lên :
05/09/2013, 09:38
... determined by using a TOC analyzer (TOC-5000, Shimadzu, Kyoto, Japan) Ammonia and nitrite were analyzed by phenate method [15] and by colarimetric method [16], respectively Nitrate was analyzed by an ... Water and Environment Technology, Vol 7, No 1, 2009 decarbonylation followed by demethylation, and (2) two demethylation steps followed by decarbonylation In the former pathway, dimethylamine and ... containing 870 μL of sludge, 120 μL of 50 mM CTC, and 10 μL of the substrate mixture (0.05% for peptone and yeast extract and mM for glucose and succinate) was incubated in a water bath at 30 °C...
- 8
- 433
- 0
ENGLISH ADVERBS OF MANNER AND TYPICAL ERRORS MADE BY THE STUDENTS AT LE HONG PHONG SPECIALISED SECONDARY SCHOOL, NAM DINH CITY
Ngày tải lên :
07/09/2013, 13:19
... construction with less and less A similar construction, employing the expression less and less, can also be used The expressions less and less and more and more have opposite meanings less + and + less + ... thesis, the standard written dialect is selected as the norm Another definition of an error given by Dulay et al is that “Error is the flawed side of learner speech and writing, those parts of ... language and the target language to predict errors made by learners and tried to account for learners’ errors on the basis of linguistic differences between L1 and L2 Therefore, CA could not give accounts...
- 55
- 1.1K
- 8
Levinas and the face of the other
Ngày tải lên :
01/11/2013, 10:20
... filled by sufficient reasons.11 However, that is not because one demand is not like another The other s demand culminates in a negative command, facing the extreme possibility of murder and averting ... fact that the other is judge and accused at once (ob 12) Any previous division of roles would spill and even poison the source of justice The justice which is required by all others of the other ... and the face of the other 71 We can certainly contradict what the other says because the other is not a dogmatic authority, but we cannot contradict the call and demand of the other s face which...
- 19
- 450
- 0
A study on prepositions of direction and some errors made by vietnamese learners
Ngày tải lên :
11/12/2013, 23:53
... of direction Using these prepositions accurately the listeners and the readers will understand direction and goal we express and they will not misunderstand Besides, through this study you can ... clause is an adjective clause and a noun, the clause is an attribute clause Understanding them clearly we can use them correctly in writing and speaking On the other hand, communication will get ... nouns, and verbs must usually be followed by certain prepositions, and there are hundreds of phrasal verbs formed from combinations of verbs with adverbs and prepositions It should also be noted that...
- 55
- 1K
- 3
The primary verbs in english and the errors make by students
Ngày tải lên :
18/12/2013, 21:45
... difference between infinitive and ing form is that infinitive form is used for things that happen(ed) and the other one is for things that are/were happening Another meaning is cause somebody/something ... differently and similarly to every language In order to understand more deeply and exactly about the primary auxiliary verbs in both English and Vietnamese, the only way by contrastive analysis and comparison ... of a verb and what follows it To understand more clearly, lets consider some cases that the primary auxiliaries are used 2.2.1 The primary auxiliaries in questions and short answers: That is the...
- 52
- 621
- 2
Learning PHP, MySQL, and javascript a step by step guide to creating dynamic websites
Ngày tải lên :
24/01/2014, 15:00
... variables and other code elements, HTML tags, macros, the contents of files, and the output from commands Constant width bold Shows commands or other text that should be typed literally by the user; ... in JavaScript, from simple functions and event handling to accessing the Document Object Model and inbrowser validation and error handling With an understanding of all three of these core technologies, ... course, as mentioned earlier, you will have issued other commands to create the database and table and to set up all the correct fields, but the INSERT command here shows how simple it can be to add...
- 528
- 1.4K
- 1
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc
Ngày tải lên :
16/02/2014, 09:20
... TCTAA CAAGC T-3¢ and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A-3¢, and 5¢CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-CGACC GGTAT AATAT TGCTG AGAGC ATCCA-3¢, respectively, and pQE16–hPGK1 as ... constructed using the synthetic oligonucleotides 5¢-GATCC GGGCG CCGGA-3¢ and 5¢-CCGGT CCGGC GCCCG3¢, and phPGK1–7aa–cerulean pCMV–hGAPDH was constructed by self-ligation of the blunt-ended AgeI–BspEI ... cells C-3¢, and pcerulean-C1 For the construction of phGAPDH– 10aa–citrine, the synthetic oligonucleotides 5¢-GATCC GGGCG CCGGA-3¢ and 5¢-CCGGT CCGGC GCCCG3¢ were inserted between the AgeI and BamHI...
- 9
- 586
- 0
Tài liệu ALPHABETICAL INDEX OF REPRESENTED ORGANIZATIONS AND THEIR LEGISLATIVE AGENTS BY REGISTRATION NUMBER FOR THE THIRD QUARTER 2002 docx
Ngày tải lên :
16/02/2014, 10:20
... 721 National Indemnity Insurance Co 1228 National Kitchen & Bath Assn 970 National Marine Manufacturers Assn 365 National Maritime Safety Assn 1264 National Nutritional Foods Assn/NNFA 547 National ... Fragrances Inc 403 International Game Technology 1112 International Game Technology 1247 International Longshoremans Assn AFL-CIO 453 International Longshoremans Assn AFL-CIO 771 International Matex Tank ... 337 National Assn of Fee Appraisers of NJ 100 National Assn of Independent Fee Appraisers 939 National Assn of Independent Insurers 289 National Assn of Independent Life Brokerage Agencies 365 National...
- 51
- 574
- 0
Tài liệu Formal and informal institutions’ lending policies and access to credit by small-scale enterprises in Kenya: An empirical assessment doc
Ngày tải lên :
16/02/2014, 10:20
... physical access Aryeetey and Gockel (1991) examine some of the factors that influence demand for formal savings and lending facilities in Ghana and observe that incomes, bank formalities and banks’ ... household and enterprise characteristics between those who had used credit and those who had not, as well as between those who used formal sources and those who used informal sources, showed that ... observation from this is that the access to credit and the limited use by enterprises is mainly determined by the supply side of the market, rather than the demand side We therefore argue that in this market,...
- 53
- 549
- 0
Tài liệu Anomalies and Curiosities of Medicine, by George M. Gould and Walter Lytle Pyle doc
Ngày tải lên :
17/02/2014, 07:20
... argument by a full citation of parallels to any remarkable theory or hypothesis advanced by his clients; and it is only by an exhaustive knowledge of extremes and anomalies that an authority ... of the liver, or the brain itself,—may be lost by accident, and the patient still live, the physician is taught the lesson of nil desperandum, and that if possible to arrest disease of these organs ... s'offre a l' Homme quand il se regarde, c'est son corps," says Pascal, and looking at the matter more closely we find that it was the strange and mysterious things of his body that occupied man's earliest...
- 3.6K
- 931
- 0