... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... head mod B isa = major, (damage/noun) = Y= cat noun nr sg head isa = damage II Derived Semantic Molecule (major damage) = cat n nr sg head X isa = major, X.Y= , X.isa=damage III Constraint ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed...
Ngày tải lên: 08/03/2014, 02:21
... Project Management Team Risk Management Principles 11 Team Risk Management Functions 12 Scenario Comparing Team Risk Management to Risk Management 17 Advantages of Team Risk Management 19 Answers ... priorities 18 Advantages of Team Risk Management Introduction Team Risk Management offers a number of advantages for a project, as compared to individual or group risk management However, it also involves ... Management function and describes a typical activity in risk management compared to a typical activity in Team Risk Management Function Initiate In Risk Management There is no comparable activity...
Ngày tải lên: 23/03/2014, 23:21
Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx
... Statistical Analyses Part One Functional Movement Screen Data was coded using Stata 8.0 For exploratory data analysis we used bivariate methods The primary hypothesis was assessed with multivariate analysis ... Environmental Occupational Health Unit, The College of Public Health, University of Arizona, Tucson, Arizona, USA References National Institute of Occupational Safety and Health (NIOSH): National Occupation ... One approach has been to examine the relationship between simulated firefighting tasks and physical performance or functional measures [14] Researchers have demonstrated that activities such as...
Ngày tải lên: 20/06/2014, 00:20
Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx
... industry Additional results are available at www.relationshipera.com, and details of the Brand Sustainability Map research methodology are available at www.relationshipera.com/brand-sustainability/bsm-info/ ... product—they are passionate brand partners Principle #5: Engage Many marketers and agencies talk about an integrated approach to marketing, using a variety of tools to reach consumers In the Relationship ... shallow approach to trust as they employ a new model of marketing Changing Within a Model versus Creating a New Model Although businesses constantly evolve, most change happens within a fundamental...
Ngày tải lên: 27/06/2014, 23:20
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head ... titanate particles appeared in the permanent cavity along the bullet path The cavity was covered with barium titanate particles along the entire bullet path Analysis of the temporary cavity To analyze ... each block (GE Medical Systems, Lightspeed, USA) at 120 kV and 200 mA Analysis The data obtained were stored in a digital format (DICOM) and transferred to a personal computer for further analysis...
Ngày tải lên: 11/08/2014, 20:21
The future of finance a new model for banking and investment
... removing many protectionist barriers Globalization flourished as markets opened up; new capital was made available to business with Latin America, Asia, and Central and Eastern Europe.1 A paradox of ... “qualitative” analysis that can be applied, and which would influence the rating, because, unlike a corporation, a CDO is simply a brass plate on a wall Unfortunately, CDO quantitative analysts and ... Remuneration Model Unsuitable Personal Behavior Conclusion CHAPTER Bank Capital Safeguards: Additional Capital Buffers and Reverse Convertibles Capital Issues in a Bear Market Looking for New Capital...
Ngày tải lên: 30/10/2014, 16:18
Beyond the three circles a new model for world englishes
... well as the native speaker‟s „prerogative to control its standardisation‟ (Kachru, 1985:29-30) And as part of a wider Kachruvian paradigm (Canagarajah, 1999:180) that has shaped the agenda for ... 1985:29-30) And as part of a wider set of beliefs, a Kachruvian paradigm (Canagarajah, 1999:180) as it were, that has shaped the agenda for the treatment of the variation and pluricentricity that exists ... the traditional 23 language or languages that are available to the members of that particular group And according to Kachru, nativization may be seen in the areas of context, cohesion and cohesiveness,...
Ngày tải lên: 01/10/2015, 11:39
A New Model for Network Traffic Based on Alpha Stable Self similar ...
... , and M s is an the dispersion and the mean or median of the distribution alpha-stable random measure on R with Lebesque A random variable X that follows an alpha-stable control measure The new ... network traffic So the new model can provide comparing the simulation traces of the three models with great advantages in the future research the actual network data, it is shown that the new model ... is said that the new the alpha-stable distribution, and then a new model is model is better than the other models in fitting the actual advanced based on the LFSN processes In terms of packets...
Ngày tải lên: 14/11/2015, 08:03
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx
... comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, stem-cell-like neuroblasts have been detected that ... populations Genetic variation has been reported in Daphnia for a vast number of traits such as size, aging, Page of behavior (for example, vertical migration, fish-escape behavior), morphology (for ... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly...
Ngày tải lên: 06/08/2014, 19:21
Báo cáo y học: "Determination of normal values for navicular drop during walking: a new model correcting for foot length and gender" ppt
... analysis All data except age were parametric and therefore the Pearson product moment correlation was used The Spear- man's rank correlation was used in the analysis of age Correlations and stepwise ... calcaneus and first metatarsal head The distance between the floor and the line in standing position between the markers on calcaneus and first metatarsal were added afterwards ND was calculated ... took part in data acquisition, made the statistical analysis and interpretation of data, and helped drafting the manuscript OS and HL took part in revising the manuscript critically for important...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "The significance of glucose, insulin and potassium for immunology and oncology: a new model of immunity" ppt
... 6(2): Dandona P, Aljada A, Chaudhuri A, Bandyopadhyay A: The potential influence of inflammation and insulin resistance on the pathogenesis and treatmentof atherosclerosis-related complications in ... Day Values are Mean ± SEM Figure activity against murine melanoma B16-F10 in C57BL/6 mice following TGIK administration via different routes of administration Antitumor Antitumor activity against ... TGIK formulation was compared against GK and TGK as well as a saline control We hypothesized that if a cancer patient were to be administered thyroid and insulin (to stimulate the sodium/potassium...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
Ngày tải lên: 31/10/2012, 14:59
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx
... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... subconscious mind, and manifest your desires Affirmations are not all created equal Some are, of course, better than others There are *power affirmations* that have been proven again and again to work...
Ngày tải lên: 15/12/2013, 06:15
A new algorithm for enumeration of minimum cutsets of graph by branch addition
... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... node 4Figure 6: Khorasan regional network as a case study and its node-branch connection table Output node Figure 7: Shadmehr substation diagram Figure 8: Ghaenat substation diagram VIII REFERENCES...
Ngày tải lên: 03/01/2014, 19:35
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx
... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... sensory channel for virtual experiences It has the advantage of being a channel of communication that can be processed in parallel with visual information The most apparent use is to provide auditory...
Ngày tải lên: 23/01/2014, 07:20
Tài liệu A New Era for Conservation docx
... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...
Ngày tải lên: 25/01/2014, 20:20
Tài liệu A Global Model for Regulatory Reform doc
... Information Technology Agreement II … are countries on use of standards and SDoC US and EU have asked for talks leading to a signed agreement APEC World Trade Organizations surveying …… APEC has ... Declaration of Conformity option June 24, 1998 Model for Regulatory Reform One Standard feedback Designed once to internationally-accepted global standards Market Surveillance Product sample and ... Standard on what are the requirements and content of a Compliance Folder and a Declaration of Conformity Guidance on market surveillance methods that a government should consider Conform to administrative...
Ngày tải lên: 26/01/2014, 02:20
Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf
... Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation Intermediate Maintenance AVN Aviation AWCF Army Working Capital Fund CASCOM Combined Army Support Command CTASC Corps/Theater ... parts that are unavailable at the SSA might not arrive for a week or more But despite the advantages of having parts available from the supporting SSA, Army inventory managers determining what to ... MR-1150 -A, 2002; Marygail K Brauner et al., Dollars and Sense: A Process Improvement Approach to Logistics Financial Management, Santa Monica, CA: RAND Corporation, MR-1131 -A, 2000; and Marygail...
Ngày tải lên: 17/02/2014, 17:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
Ngày tải lên: 18/02/2014, 17:20