Ngày tải lên: 27/06/2014, 23:20
... investigation into the role of metaphor in description of emotion in poetic discourse clause Circumstance participant Process Circumstance Place in her heart Process has grown Actor a secret love Time Lately Clause Theme Lately Rheme a ... The objective of the study is: - To examine the characteristics of metaphor in poetry from the approach of Systemic Functional Linguistics. More details on the aimed objective of the study ... both the types of speech role that they are taking on in the dialogue and the whole cluster of socially significant relationships in which they are involved? + The MODE OF DISCOURSE concerns...
Ngày tải lên: 07/11/2012, 14:44
The graphs below show the types of music albums purchased by people in Britain according
Ngày tải lên: 04/10/2012, 10:02
Introduction to the basic approaches and issues of Intrusion Detection
... Sector Center * Increase physical security including: - Enhance remote site surveillance and security * Increase network security including: - Restricted access to Internet - Increase frequency ... Round -the- clock staffing of Sector Center * Report new Category I and II incidents within 24 hrs to Sector Center * Increase physical security including: - Enhance remote site surveillance and security * ... Physical protection of critical network elements * Further increase network security including: - Restrict access to Internet - Further restrict remote access to key system elements * Increase...
Ngày tải lên: 04/11/2013, 13:15
Tài liệu Linux Device Drivers-Chapter 10 :Judicious Use of Data Types doc
... string'' because the normal C data types are not the same size on all architectures. To show the data size of the various C types, the datasize program has been included in the sample files ... struct list_head being used, type _of_ struct is the type of the structure containing the ptr, and field _name is the name of the list field within the structure. In our todo_struct structure ... matter of fact, the compiler signals type inconsistencies even if the two types are just different names for the same object, like unsigned long and u32 on the PC. Interface-Specific Types...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu Types of pacemakers and the hemodynamics of pacing pptx
... !"#"! 5 Types of Pacemakers and the Hemodynamics of Pacing Permanent Pacemaker Types Pacemaker Code ""$ ... &'!> %NN5%L:%7' Authors: Moses, H. Weston; Mullin, James C. Title: A Practical Guide to Cardiac Pacing, 6th Edition ... L"""000' >E")"(*5 "@AB@AC"'-*("" @AB'@AC"*""(" )*" )M)$""L&'"" "("))"")* "' "/...
Ngày tải lên: 24/01/2014, 01:20
Tài liệu Health of Children Living in Urban Slums in Asia and the Near East: Review of Existing Literature and Data pdf
... disaggregation of urban data by socioeconomic criteria and location ã Lack of agreement on what constitutes a slum or where slums are located ã Lack of official recognition of the existence of slum settlements ... status of current urban programming 7. “Conclusions and Recommendations for Action” Discussion of the Nature of Existing Urban Health Data The search for data on child health specifically in ... around Cairo were created in the last decade. The inhabitants are among the poorest of the poor in Greater Cairo. 44 The results of sociological and other urban studies are extremely hard to access,...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu Fertility, Family Planning, and Women’s Health: New Data From the 1995 National Survey of Family Growth pptx
... thepopulation.Thenumberofwomen sherepresentsinthepopulationiscalled hersamplingweight.Sampling weightsmayvaryconsiderablyfromthis averagevaluedependingonthe respondentsrace,theresponseratefor similarwomen,andotherfactors.As withanysamplesurvey,theestimatesin thisreportaresubjecttosampling variability.SignicancetestsonNSFG datashouldbedonetakingthesampling designintoaccount. Nonsamplingerrorswereminimized bystringentquality-controlprocedures thatincludedthoroughinterviewer training,checkingtheconsistencyof answersduringandaftertheinterview, imputingmissingdata,andadjustingthe samplingweightsfornonresponseand undercoveragetomatchnationaltotals. Estimatesofsamplingerrorsandother statisticalaspectsofthesurveyare describedinmoredetailinanother separatereport(13). Thisreportshowsndingsby characteristicsofthewomaninterviewed, includingherage,maritalstatus, education,parity,householdincome dividedbythepovertylevel,andraceand Hispanicorigin.Ithasbeenshownthat blackandHispanicwomenhavemarkedly lowerlevelsofincome,education,and accesstohealthcareandhealthinsurance, thanwhitewomen(14).Theseandother factors,ratherthanraceororiginperse, probablyaccountfordifferencesinthe behaviorsandoutcomesstudiedinthis reportamongwhite,black,andHispanic women(15). TableBshowsafactorthatshould beconsideredininterpretingtrendsin pregnancy-relatedbehaviorintheUnited States:thechangingagecompositionof thereproductive-agepopulation.In 1982,therewere54.1millionwomenof reproductiveageintheUnitedStates;in 1988,57.9million;andin1995,60.2 million(16).Thelargebabyboom cohort,bornbetween1946and1964, was1834yearsofagein1982,2442 yearsofagein1988,and3149years ofagein1995.Theselargebirthcohorts werepreceded(upto1945)and followed(196580)bysmallercohorts. Whiletheoverallnumberofwomen 1544yearsofageroseby6million,or 11percentbetween1982and1995 ,the numberofteenagewomendroppedby about6percent,thenumberofwomen 2024yearsofagedroppedby 15percent,andthenumberofwomen 2529droppedby6percent(tableB).In contrast,thenumberofwomen3044 yearsofageincreasedsharplyfor example,thenumberofwomen4044 yearsofageincreasedby59percent between1982and1995.Also,women 3044yearsofageaccountedfor 54percentofwomen1544yearsofage in1995comparedwith44percentin 1982.Thesedifferencesinage compositionmayberelevantwhenever timetrendsamongwomen1544years ofagearebeingdiscussed. Publicuselesbasedonthe1995 NSFGareavailableoncomputertape. TheywillalsobeavailableonCompact DiscRead-OnlyMemory(CD-ROM). Questionsaboutthecostandavailability ofthecomputertapesshouldbedirected totheNationalTechnicalInformation Service(NTIS),5285PortRoyalRoad, Springeld,VA22161,703487-4650, or1800-553-NTIS.Questionsregarding theCD-ROMlesshouldbedirectedto NCHSDataDisseminationBranchat 301436-8500. Results T ables117containmeasuresof pregnancyandbirthintheUnited States. ChildrenEverBornandTotal BirthsExpected In1995,women1544yearsof ageintheUnitedStateshadhadan averageof1.2birthsperwoman (table1).Thiscompareswith1.2in 1988and1.3in1982(17).In1995, women1544yearsofageexpectedto nishtheirchildbearingwithan averageof2.2childrenperwoman (table1)comparedwith2.2in1988 and2.4in1982(17). Theproportionwhoreportthatthey haveneverbeenpregnantwasmarkedly higherforcollegegraduatesthanfor thosewhodidnotcompletehighschool (table3).Thissamepatternbyeducation isalsoseenwhendataforlivebirthsare examined(tables45):about49percent ofwomen2244yearsofagewhohad graduatedfromcollegehadhadnolive birthsasofthedateofinterview comparedwithjust8percentofwomen 2244yearsofagewithoutahigh schooldiploma(table4).Withinrace andHispanicorigingroups,thepattern wasthesame:collegegraduateshad markedlyhigherpercentschildlessthan womenwithlesseducation(table5). Table6showsacomparison betweenlivebirthsreportedinthe NSFGandlivebirthsregisteredonbirth certicatesintheyears199194.In eachindividualcalendaryearandfor thesumoftheyears199194 ,the NSFGestimateofthenumberofbirths isveryclosetothebirthcerticatetotal anddiffersfromitbylessthanthe NSFGssamplingerror.TheNSFG estimateisalsoverycloseforwhite women.TheNSFGestimateforblack womenisslightlylower,andthe estimateforotherracessomewhat higherthanthebirthcerticatedata.A discussionofthisdifferenceisgivenin thedenitionofRaceandHispanic originintheDenitionsofTerms. Overall,andbycharacteristicsother thanrace,however,table6showsthat TableB.Numberofwomen,byage:UnitedStates,1982,1988,and1995 Ageơ ... of women 15–44 years of age and percent distribution by number of pregnancies, according to selected characteristics: United States, 1995 Characteristic Number in thousands Number of pregnancies 1 Total ... thepopulation.Thenumberofwomen sherepresentsinthepopulationiscalled hersamplingweight.Sampling weightsmayvaryconsiderablyfromthis averagevaluedependingonthe respondentsrace,theresponseratefor similarwomen,andotherfactors.As withanysamplesurvey,theestimatesin thisreportaresubjecttosampling variability.SignicancetestsonNSFG datashouldbedonetakingthesampling designintoaccount. Nonsamplingerrorswereminimized bystringentquality-controlprocedures thatincludedthoroughinterviewer training,checkingtheconsistencyof answersduringandaftertheinterview, imputingmissingdata,andadjustingthe samplingweightsfornonresponseand undercoveragetomatchnationaltotals. Estimatesofsamplingerrorsandother statisticalaspectsofthesurveyare describedinmoredetailinanother separatereport(13). Thisreportshowsndingsby characteristicsofthewomaninterviewed, includingherage,maritalstatus, education,parity,householdincome dividedbythepovertylevel,andraceand Hispanicorigin.Ithasbeenshownthat blackandHispanicwomenhavemarkedly lowerlevelsofincome,education,and accesstohealthcareandhealthinsurance, thanwhitewomen(14).Theseandother factors,ratherthanraceororiginperse, probablyaccountfordifferencesinthe behaviorsandoutcomesstudiedinthis reportamongwhite,black,andHispanic women(15). TableBshowsafactorthatshould beconsideredininterpretingtrendsin pregnancy-relatedbehaviorintheUnited States:thechangingagecompositionof thereproductive-agepopulation.In 1982,therewere54.1millionwomenof reproductiveageintheUnitedStates;in 1988,57.9million;andin1995,60.2 million(16).Thelargebabyboom cohort,bornbetween1946and1964, was1834yearsofagein1982,2442 yearsofagein1988,and3149years ofagein1995.Theselargebirthcohorts werepreceded(upto1945)and followed(196580)bysmallercohorts. Whiletheoverallnumberofwomen 1544yearsofageroseby6million,or 11percentbetween1982and1995 ,the numberofteenagewomendroppedby about6percent,thenumberofwomen 2024yearsofagedroppedby 15percent,andthenumberofwomen 2529droppedby6percent(tableB).In contrast,thenumberofwomen3044 yearsofageincreasedsharplyfor example,thenumberofwomen4044 yearsofageincreasedby59percent between1982and1995.Also,women 3044yearsofageaccountedfor 54percentofwomen1544yearsofage in1995comparedwith44percentin 1982.Thesedifferencesinage compositionmayberelevantwhenever timetrendsamongwomen1544years ofagearebeingdiscussed. Publicuselesbasedonthe1995 NSFGareavailableoncomputertape. TheywillalsobeavailableonCompact DiscRead-OnlyMemory(CD-ROM). Questionsaboutthecostandavailability ofthecomputertapesshouldbedirected totheNationalTechnicalInformation Service(NTIS),5285PortRoyalRoad, Springeld,VA22161,703487-4650, or1800-553-NTIS.Questionsregarding theCD-ROMlesshouldbedirectedto NCHSDataDisseminationBranchat 301436-8500. Results T ables117containmeasuresof pregnancyandbirthintheUnited States. ChildrenEverBornandTotal BirthsExpected In1995,women1544yearsof ageintheUnitedStateshadhadan averageof1.2birthsperwoman (table1).Thiscompareswith1.2in 1988and1.3in1982(17).In1995, women1544yearsofageexpectedto nishtheirchildbearingwithan averageof2.2childrenperwoman (table1)comparedwith2.2in1988 and2.4in1982(17). Theproportionwhoreportthatthey haveneverbeenpregnantwasmarkedly higherforcollegegraduatesthanfor thosewhodidnotcompletehighschool (table3).Thissamepatternbyeducation isalsoseenwhendataforlivebirthsare examined(tables45):about49percent ofwomen2244yearsofagewhohad graduatedfromcollegehadhadnolive birthsasofthedateofinterview comparedwithjust8percentofwomen 2244yearsofagewithoutahigh schooldiploma(table4).Withinrace andHispanicorigingroups,thepattern wasthesame:collegegraduateshad markedlyhigherpercentschildlessthan womenwithlesseducation(table5). Table6showsacomparison betweenlivebirthsreportedinthe NSFGandlivebirthsregisteredonbirth certicatesintheyears199194.In eachindividualcalendaryearandfor thesumoftheyears199194 ,the NSFGestimateofthenumberofbirths isveryclosetothebirthcerticatetotal anddiffersfromitbylessthanthe NSFGssamplingerror.TheNSFG estimateisalsoverycloseforwhite women.TheNSFGestimateforblack womenisslightlylower,andthe estimateforotherracessomewhat higherthanthebirthcerticatedata.A discussionofthisdifferenceisgivenin thedenitionofRaceandHispanic originintheDenitionsofTerms. Overall,andbycharacteristicsother thanrace,however,table6showsthat TableB.Numberofwomen,byage:UnitedStates,1982,1988,and1995 Ageơ...
Ngày tải lên: 12/02/2014, 23:20
Tài liệu Fertility, Family Planning, and Reproductive Health of U.S. Women: Data From the 2002 National Survey of Family Growth doc
... The NSFG conducted in 2002, being the sixth in the series, is referred to as Cycle 6. Cycle 6 of the NSFG was conducted under contract with the University of Michigan’s Institute for Social ... 53–66) The use of contraception and the specific methods of contraception used are major factors affecting the pregnancy and birth rates in the United States. A number of tables on contraceptive ... percent of white adoption seekers would prefer or accept a black child and 95 percent would prefer or accept a child of a race other than black or white. Use of Family Planning and Other...
Ngày tải lên: 13/02/2014, 10:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... expres- sion of HO-2 promoter constructs in YN-1 cells (Fig. 7B). In contrast, hypoxia consistently increased the promoter activity of a construct, HRESV40, which contains four copies of HRE, but ... marginal effects on the promoter activity of NHRESV40, a negat- ive control for hypoxic induction. Hypoxia increases cellular heme contents in human cell lines To explore the implication for the reduced ... for the HRE constructs. This study was supported by Grants-in-aid for Scienti c Research (B), for Scienti c Research on Priority Areas, and by the 21st Century COE Program Special Research Grant, the...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt
... CAGCAGGATCCTCTAGAGAGTTTAGTCTT TG-3Â)anda5Â-terminus primer (one of 5Â-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3Â,5Â-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3Â,5Â-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3Â ... ¢-AAG CTTCACCATGGAGCGGATCCCCAGCGCGCAACC AC-3¢)anda3¢-terminus primer (one of 5 ¢-TCTA GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA TGG-3¢,5¢-TCTAGACTACCCACTCGAGTGAGCGA AAGTCCGCTGG-3¢ or 5¢-TCTAGACTATTGACCTG TTTCGACATTTCTCCCTGACAGCTC-3¢)wereused for ... 5Â-CTTGCTGTCCTCG CTCCGCTTTATTCCC-3 Â for DEC1DbHLH and DEC1:4232DbHLH; 5Â-GACCGGATTAACGAGTGC ATCGCCCAG-3Â and 5 Â-CTTGCTGTCCTCGCTCCGC Fig. 1. Suppress ive activity of DEC1 against the CLOCK/BMAL1-activated...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx
... A char data type can hold one character and it requires one byte. If you need store a name of a customer in the memory you have to declare an array of characters or use an object of the C+ + ... outfile.open("a:circle.txt"); /* assign a DOS name to the handle. creates a file called circle.txt in floppy drive A: */ outfile << "Enter the radius of the circle in cm? " ... character long, a dot, and 3 character extension. You may include the drive letter and path in front of the file name. For example: C: \mydocuments\cprograms\printfiles\carpet.txt 4. Place...
Ngày tải lên: 20/02/2014, 08:20
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt
... shell of the program as follows, save it to the appropriate subdirectory. If you are using the campus computer, save to c: \temp\yourfilename.cpp. Replace yourfilename with whatever name you ... name you want to call it. Compile the program and make sure that there no errors. Remember to copy the yourfilename.cpp to your floppy disk before logging out of the computer. Once you logout ... chart and show the data flow. Next, write the psuedocode for each of the modules. A structure chart tells you what to do, a psuedocode tells you how to do it. I will cover this in class at great...
Ngày tải lên: 20/02/2014, 08:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... sequence previously acquired by chemical sequencing, the oligonucle- otide ccNiR_GTPRNGPW, 5Â-GGIACICCIMGIAAYG GICCITGG-3Â, was synthesized and used together with the primer ccNiR_Cterm, 5Â-TCYTGICCYTCCCASACYT GYTC-3Â, ... involved. Purification attempt of a soluble form of ccNiR Nitrite reductase activity was checked in the soluble cell fraction in order to investigate the existence of a soluble monomeric form of ccNiR, ... periplasmic pentahemic cytochrome c, NrfB [22]. These important developments demand the re-examina- tion of the biochemical properties of D. desulfuri- cans ATCC 27774 ccNiR, and its implications on the existing...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Cell surface heparan sulfate proteoglycans Target and partners of the basic ®broblast growth factor in rat Sertoli cells pptx
... are deđned for the bFGF binding and for the recognition of the speci c bFGF receptor, leading to the formation of a ternary complex comprising HSPG±bFGF±FGFR. These oligosaccharidic motifs are ... extraction, cells were incubated for 24 h either in the absence or in prese nce of FSH, dbcAMP, cholera toxin or bFGF, either in combination with FSH or dbcAMP or cholera toxin and bFGF. Extraction ... difference in cell attachment to substratum (data not shown) as the DNA content o f the cell layer at the end of the 24 h incubation period was i dentical in untreated and bFGF-treated Sertoli cell cultures...
Ngày tải lên: 21/02/2014, 03:20
Information Dashboard Design: The Effective Visual Communication of Data pdf
... ardsintovarious types. The waythatrelates mostdirectlytoadashboard'svisualdesigninvolves the roleitplays,whetherstrategic,analytical,or operational. The designcharacteristics of the dash boardcanbetailoredtoeffectivelysupport the needs of each of theseroles.Whilecertaindifferencessuchasthesewillaffectdesign,therearealsomany commonalitiesthatspanalldashboardsandinviteastandardset of designpractices. www.it-ebooks.info ... the graphinFigure3‐12showslittleregard for the viewer'stimeandnounderstanding of visualperception.Thisgraphcomparesrevenuetooperating costsacrossfivemonths,using the size of overlappingcircles(sometimescalledbubbles)toencode the quantities.Justaswith the slices of apie,usingcirclestoencodequantityrelieson the viewer'sabilityto comparetwo‐dimensionalareas,whichwesimplycannotaccuratelydo.Take the valuesfor the month of Februaryasanexample.Assumingthatoperatingcostsequal$10,000,whatis the revenuevalue? Figure3‐12.Thisgraphuses the two‐dimensionalarea of circlestoencodetheirvalues,whichneedlesslyobscures the data. Ournaturaltendencyistocompare the sizes of the twocirclesusingasingledimensionlen gthor widthequalto the diameter of each,whichsuggeststhatrevenueisaboutthreetimesthat of operating costs,orabout$30,000.Thisconclusioniswrong,however,toahugedegree. The two‐dimensionalarea of the revenuecircleisactuallyaboutninetimesbiggerthanthat of the operatingcostscircle,resultingina value of $90,000.Oops!Notevenclose. Nowcompareoperatingcostsfor the months of FebruaryandMay.ItappearsthatcostsinMayaregreater thanthoseinFebruary, right?Infact, the interiorcirclesare the samesizemeasurethemandsee. The revenuebubbleinMayissmaller ... coverwhatiscausing the decreaseandhowitmightbecorrected. The dashboarditself, asamonitoringdevicethattells the analystwhattoinvestigate,neednotsupportall the subsequent interactionsdirectly,butitshouldlinkasseamlesslyaspossibleto the meanstoanalyze the data. 2.1.1.3.Dashboardsforoperationalpurposes Whendashboardsareusedtomonitoroperations,theymustbedesigneddifferentlyfromthosethat supportstrategicdecisionmakingor data analysis. The characteristic of operationsthat uniquelyinfluences the design of dashboardsmostistheirdynamicandimmediatenature.Whenyoumonitoroperations,you mustmaintainawareness of activitiesandeventsthatareconstantlychangingandmightrequireattention andresponseatamoment'snotice.If the roboticarmon the manufacturingassemblylinethatattaches the cardoorto the chassisrunsout of bolts,youcan'twaituntil the nextdaytobecomeaware of the problemandtakeaction.Likewise,iftrafficonyourwebsitesuddenlydropstohalfitsnormallevel,you wanttobenotifiedimmediately. Aswithstrategicdashboards, the displaymediaonoperationaldashboardsmustbeverysimple....
Ngày tải lên: 06/03/2014, 17:20
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
Ngày tải lên: 07/03/2014, 21:20
From Patient Data to Medical Knowledge The Principles and Practice of Health Informatics ppt
Ngày tải lên: 15/03/2014, 12:20