... Peplow, F. Yamakura and T. Matsumoto for the analyses of iron and manganese in protein samples. We also wish to thank H. Steinman for the gift of E. coli OX32 6A. We finally thank Mr M. Farrugia for ... incubated at 50 °Cfortheindicated times. Aliquots were removed for analysis of SOD activity and were calculated to give 1 unit of SOD activity in the standard SOD assay conditions used and all values ... program CE [35] while mutational analyses were carried out using the CARA and ENCAD algorithms included in the GENEMINE program. Bacterial strains and vectors The mutagenesis and expression phagemid,...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... 5–8). The pK a of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142 ... glycosyl- transferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436. 16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme. To obtain an insight...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synthetic Chemistry and Biological Chemistry, Graduate ... products, AclA (a subunit) and AclB (b subunit). By comparing the primary structures of AclA and AclB with that of the mammalian enzyme, we found that AclA and AclB Correspondence to T. Imanaka, Department ... lanes 2 and 5, and AclB subunits (b) in lanes 3 and 6. Molecular masses (kDa) are indicated on the side of each panel. The asterisk indicates the degradation product of AclA described in the text. Fig....
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... B=MIC B ị=n where A and B are the MICs of drug A and drug B in the combination, MIC A and MIC B are the MICs of drug A and drug B alone, FIC A and FIC B are the FICs of drug A and drug B and n is the number of ... purchased from Avanti Polar Lipids (Alabaster, AL, USA). FITC-Ds were purchased from Sigma. All other chemicals were reagent grade. For antimicrobial assays, the commercially available quality ... pleurocidin derivatives and buforin 2, do not disturb the membrane of E. coli at their minimal antimicrobial concentrations, but rather traverse it, accumulate intracellularly, and damage a variety of essential...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V, Jasmani S, Okuno A, Ohira T, Okumura T, Aida K & Wilder MN (2004) Molecular characterization of a cDNA encoding vitellogenin in the coonstriped ... dsRNA, DNA corresponding to the mature peptide of MeMIH-B was amplied by PCR using T7 promoter-linked primers (forward, 5Â-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3Â; reverse, 5Â-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3Â). ... nmol or 0.66 nmol of rMIH-B at the arthropodial membrane of the periopod and returned to the culture tanks. At 24, 48 and 72 h after injection, the hepatopan- creas and ovary of the shrimp were...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... DosH as a template and using the following respective 5Â-sense primers: 5Â-gatga gtcgggagACCcagctggagaaaaaag-3Â,5Â-gatgagtcgggagTTTcag ctggagaaaaaag-3Â,5Â-ggacccgttttgcgACCtcgaaagtgagc-3Â, and ... decreased the rate of auto-oxidation [5], whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water mole- cules with the proximal ligand His77, markedly increased ... mutations, although the effects of the Leu99 and Leu115 muta- tions were modest compared with those of Met95 mutations. It seems likely that potential data based on our data and that of others have accuracies of...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... dysfunction. ACKNOWLEDGEMENTS We thank Drs Carlos E. Argaran ˜ a and Mario Guido for critical reading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachner for technical assistance and Dr Stephen Anderson for ... incorporation of the radioactive analogue. Similarly, when tubulin was first blocked with nonradioactive nitrotyrosine and then incu- batedwithradioactivetyrosine,noradioactivitywas incorporated (data ... days. The antisera were usually collected 15 days after each injection and tested for affinity and specificity and stored at )20 °C. Mouse monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt
... that the PAS domain of the phosphorelay histidine kinase A of Bacillus subtilis was recently shown to be a catalytic ATP-binding domain [31]. As the PAS domain of BvgS contains a putative ATP binding ... energy of a cell, and it was recently shown that they can bind small ligands such as FAD and ATP [13,29,31]. In fact, mutations in this domain have been reported which cause either the inactivation ... the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer. The half-life of phosphorylated...
Ngày tải lên: 17/03/2014, 23:20
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... centric approach to business and accounting. And in the United States, the internationalization of accounting standards may lead to a change in the language of accounting. The growth of outsourcing ... volatility. Our research identified globalization 1 as a significant and growing trend impacting internal audit today and in the future. As organizations expand to take advantage of global markets and supply ... trends appear to be closely related: increased globalization and advances in technology will have a direct impact on talent, and there are notable ties between what participants had to say about...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC VL5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC VL6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: A natural osmolyte trimethylamine N-oxide promotes assembly and bundling of the bacterial cell division protein, FtsZ and counteracts the denaturing effects of urea docx
... denaturing effects of urea Arnab Mukherjee, Manas K. Santra, Tushar K. Beuria and Dulal Panda School of Biosciences and Bioengineering, Indian Institute of Technology Bombay, Mumbai, India Organisms, including ... is entropically unfavorable and it becomes more unfavo- rable with increasing surface area of the protein. Osmolytes may decrease the solvent-accessible surface area of proteins and the reduction in the ... 6). Taken together, these results indicated that TMAO increased the light-scattering signal of the assembly reaction and sedimentable polymer mass by enhancing the formation of larger bundles of...
Ngày tải lên: 30/03/2014, 16:20
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... 5Â-AACCATGGCTAAAGCAGATTGTAATGG TGCATGT-3Â; the 4-kDa peptide C-terminal primer: 5Â-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3Â. The amplied sequence was cloned into the plasmid pKF18 via the EcoRI and SalI ... residues at the A- chain N-terminus (GlyA1–IleA2–Val1 3A) [24,25], the A- chain C-terminus (TyrA19 and AsnA21) [26], the B-chain central helix (ValB12 and TyrB16) [27], and the B-chain C-terminal b strand ... DNAs as templates and the synthetic primers legF1 (5Â-AGC AGCAGATTGTAATGGTG-3Â)andlegR1(5Â-CAGC ACTTCAGAATCAGAGTC-3Â). PCR products were cloned on pT7Blue T-vector (Novagen, Darmstadt) and their...
Ngày tải lên: 31/03/2014, 07:20
Outline môn Tiếng Anh - What are the good and bad points of advertising from the view point of a consumer?
... methods also help the suppliers be active choosing what particular customers for advertisement objects . What are the good and bad points of What are the good and bad points of advertising ... customers usually receive the leaflets after that they throw away or if they read it but they can’t remember information of the suppliers Advertising has both good and bad points. Therefore, ... 1102015087 MAI CHAU DAN THANH 1102015096 BUI THI HOANG ANH 1102015001 TOPIC 13 By what means can a product or a servicebe advertised? Briefly present the strengths and weaknesses of each means A product...
Ngày tải lên: 02/06/2014, 15:10
kidd - 1808 - remarks and experiments on the different parts of brewing
Ngày tải lên: 12/06/2014, 11:36
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx
Ngày tải lên: 20/06/2014, 22:20