multiple linked documents into a single gene profile

... contained one of the defined CpG islands Methylation data for Arabidopsis thaliana and Oryza sativa DNA methylation in the Arabidopsis genome was mapped for wild-type roots using tiling microarrays ... purification and sequencing of methylated DNA JL processed the raw sequencing data and participated in data analysis TYK participated in sample preparation YJK participated in study design and coordination, ... DNA We purified genomic DNA with the aid of the DNeasyR Blood and Tissue Kit (Qiagen, Valencia, CA, USA) The methylated CpG island recovery assay (MIRA) [31] was carried out as follows Preparation...

Ngày tải lên: 09/08/2014, 20:20

... require a special mention are: Dr K Ananthanarayanan, Ying Ting Set, Lim Fang Jeng, Yong Chian Haw, Dr Wong Kim Hai, Thomas Gascou and Marc Daniel Heinemann Their help has been invaluable in ... annealing as a deciding factor based on the solar cell’s efficiency before and after annealing Hence, three samples, one that was not annealed, one that was annealed at 140 ºC for 30 sec and one that ... a change in the band edges for the materials at the interface Possible mechanisms that could account for this observation are a reorganization of molecules at the interface that lead to a change...

Ngày tải lên: 30/09/2015, 10:11

... surface of femoral head The normal femoral head was smooth and round, and the articular cartilage was transparent and glossy (A) After freezing, the femoral head was pale in the absence of normal ... Drugs,2002,3(7):1000-1004 Tateishi-Yuyama E, Matsubara H, Murohara T, et al Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone-marrow cells: a pilot study and a randomised ... femoral head and stayed in the femoral head for a relatively long time (Figure A- F) The surface of normal femoral head was smooth and round, and the articular cartilage was transparent and glossy...

Ngày tải lên: 25/10/2012, 11:18

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison ... Methods Animals All animal work was approved by the Institutional Animal Care and Use Committee (IACUC) of Integrated Laboratory Systems (ILS, Research Triangle Park, North Carolina, USA) or by...

Ngày tải lên: 05/03/2014, 17:20

... A, Oftedal G & Johnsson A (2005) Skin temperature increase caused by a mobile phone: a methodological infrared camera study Bioelectromagnetics 26, 510–519 ´ Vicanova J, Mommaas AM, Mulder AA, ... fibroblasts cultured from human biopsies and commercially available primary human dermal fibroblasts Normal human dermal fibroblast enriched cultures (NHDFe) were obtained from abdominal biopsies, as ... human primary epidermal and dermal cells Cells were analysed by flow cytometry using ANX–FITC ⁄ PI The percentage of viable, apoptotic and necrotic cells was determined by quadrant analysis (A) ...

Ngày tải lên: 07/03/2014, 11:20

... 2,6-sialyltransferase alpha 2,6 -linked NeuAc is preferentially attached to the Gal(beta 1–4)GlcNAc (beta 1–2) Man (alpha1–3)-branch of diantennary oligosaccharides from secreted recombinant beta-trace protein ... cell-derived material, but was rather attached to a peripheral GlcNAc residue as is indicated by the weak fragment at m/z 1021.6 [NeuNAc-Hex(dHex)HexNAc + Na] and its more intense secondary fragment at ... Purified native and desialylated oligosaccharides were analyzed by high-pH anion-exchange (HPAE) chromatography using a Dionex BioLC system (Dionex, Sunnyvale, CA, USA) equipped with a CarboPac PA1...

Ngày tải lên: 08/03/2014, 22:20

... B AVILA, Senior Project Assistant LAURA T HOLLIDAY, Research Assistant DEREK M SWEATT, Research Assistant NORMAN GROSSBLATT, Senior Editor iv Copyright © 2003 National Academy of Sciences All ... Officer JANET E JOY, Senior Program Officer ALLISON L FRIEDMAN, Research Assistant LORA K TAYLOR, Administrative Assistant ALLISON M PANZER, Project Assistant vi Copyright © 2003 National Academy ... research is the wellspring of medical breakthroughs Although private, for-profit research plays a critical role in translating the fruits of basic research into medical advances that are broadly...

Ngày tải lên: 15/03/2014, 09:20

... Giraudo CG, Daniotti JL & Maccioni HJ (2001) Physical and functional association of glycolipid N-acetyl-galactosaminyl and galactosyl transferases in the Golgi apparatus Proc Natl Acad Sci USA ... health and disease Ann Clin Lab Sci 34, 3–13 53 Daniotti JL, Martina JA, Giraudo CG, Zurita AR & Maccioni HJ (2000) GM3 alpha2,8-sialyltransferase (GD3 synthase): protein characterization and ... Investigator of CONICET (Argentina) The authors thank Alfonso Gonzalez and Marcela Bravo-Zehnder ´ (Facultad de Medicina, Pontificia Universidad Catolica de Chile) for their valuable help and advice...

Ngày tải lên: 16/03/2014, 04:20

... TTCCCCAGGAAGGCCACGG-3¢; human sPLA2-IB sense, 5¢-ATGAAACTCCTTGTGCTAGCTG-3¢ and antisense, 5¢-TCAACTCTGACAATACTTCTTGG-3¢; human sPLA2-hIIA sense, 5¢-CAGAATGATCAAGTTGACGAC AG-3¢ and antisense, 5¢-TCAGCAACGAGGGGTGCTC ... above); human cPLA 2a sense, 5¢-ATGTCATT TATAGATCCTTACC-3¢ and antisense, 5¢-TCAAAGTT CAAGAGACATTTCAG-3¢; human mPGES sense, 5¢-AT GCACTTCCTGGTCTTCCTCG-3¢ and antisense, 5¢-GC TTCCCCAGGAAGGCCACGG-3¢; ... human sPLA2-IIF sense, 5¢-ATGAAGAAGTTCTTCACCGTG-3¢ and antisense, 5¢-CTAGCAGGTGACCTCCTCAGG-3¢; human sPLA2V sense, 5¢-ATGAAAGGCCTCCTCCCACTGG-3¢ and antisense, 5¢-GGCCTAGGAGCAGAGGATGTTG-3¢; and...

Ngày tải lên: 18/03/2014, 01:20

... function as a MAPKKK protein and a potential scaffold would suggest that LRRK2 bearing artificial mutations that inactivate kinase function might show dominant negative activity in the MAPK pathway, although ... [43] Apaf1, caspase-9 and cytochrome c form the apoptosome where caspase9 undergoes a conformational change, rather than cleavage, allowing for proteolytic cleavage of substrates that can include ... mitochondria and possible release of cytochrome c, which also can lead to apoptosome formation and caspase-9 activation [45] Over-expressed LRRK2 can therefore enhance caspase cleavage in an apparent...

Ngày tải lên: 23/03/2014, 04:20

... Optical adhesive film (4311971) were purchased from Applied Biosystems (Foster City, CA, USA) 360 CAGCTTCCTCGTATCTACATTCAAGAGATG TAGATACGAGGAAGCTGTTTTT; 1179 CCATTCTGCCGTATATTGATTCAAGAGA TCAATATACGGCAGAATGGTTTTT; ... TCAATATACGGCAGAATGGTTTTT; 1624 CTCAGAGATTGCCCTTTCTTTCAAGAGA AGAAAGGGCAATCTCTGAGTTTTT The cells were then washed and replaced in fresh normal growth medium After 24 h, the cells were incubated in ... Determination of mRNA expression PHB and actin gene expression was also determined by real-time PCR, using as primers: PHB: 5¢-GATTTACAG ACAGTGGTGCACACA-3¢ (forward), 5¢-GGGTTCGTAT GGCTGGAAAA-3¢...

Ngày tải lên: 29/03/2014, 08:20

... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... signal peptide sequence: 5¢-GAATTCATGCTACTAGTAAAT CAG-3¢ (number 1) and downstream primer with a sequence complementary to the 5¢ end of poneratoxin gene and 3¢ end of a signal peptide: 5¢-CAGAAGCGGAA...

Ngày tải lên: 30/03/2014, 13:20

... 5¢-TGTCCATAGACACAGCCCTT CAG, for FAAH; (+) 5¢-AGTTGCTGCAGTTAAAA AGC (–) 5¢-CCTCAGTTCCGAAAA CCAAC, for 18S rRNA Five microliters of the reaction mixture were electrophoresed on a 6% polyacrylamide ... (CAT) activity assays, cellular extracts were prepared as described above for FAAH, and different aliquots were used for CAT assays, for b-galactosidase (b-gal) activity determination, a marker ... exclusion, and was found to be higher than 90% in all cases Materials and methods Anandamide hydrolase activity and expression Materials Chemicals were of the purest analytical grade Leptin (human recombinant),...

Ngày tải lên: 30/03/2014, 15:20

... Nakayama, Hisashi Nagase, Chang-Sung Koh and Takeshi Ohkawara Chapter Role of Growth Factor Receptors in Neural Stem Cells Differentiation and Dopaminergic Neurons Generation 189 Luc a Calatrava, ... Cells and Microglia as Valuable Research Tools 383 Bruno P Carreira, Maria Inês Morte, Caetana M Carvalho and Inês M Araújo Chapter 19 Immune System Modulation of Germinal and Parenchymal Neural ... Masaki Warashina, Makoto Asashima and Tomoko Kuwabara Chapter 12 Noncoding RNAs in Neural Stem Cell Development 239 Shan Bian and Tao Sun Part Neural Stem Cells and Therapy 257 Chapter 13 Neural Stem/Progenitor...

Ngày tải lên: 30/03/2014, 23:20

... [125I]YVP and [125I]EYF as selective radioligands Neuroscience 115, 349–361 Nakayama, K., Watanabe, T., Nakayama, T., Kim, W., Nagahama, M., Hosaka, H., Hatsuzawa, K., Kondoh-Hashiba, K & Murakami, ... Habata, Y., Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., Ibata, Y & Fujino, M (2000) New neuropeptides containing carboxy-terminal RFamide and their receptor in mammals ... sample RP-HPLC run and assessed by RIA On-line capillary HPLC/nanospray ionization MS/MS HPLC fractions were concentrated under vacuum and analyzed by on-line capillary HPLC/nanospray ionization...

Ngày tải lên: 31/03/2014, 07:20

... maintain pluripotency and proliferative potential for prolonged periods of culture Dev Biol 227, 271 - 278 Beltrami, A P., et al (2001); Evidence that human cardiac myocytes divide after myocardial ... Orlic D et al (2001); Bone marrow cells regenerate infarcted myocardium nature 410, 701 - 705 10 Shamblott, M J., et al (2001); Human embryonic germ cells derivatives express a broad range of developmentally ... Dzierzak, E et al (1998); Embryonic beginnings of definitive hematopoietic stem cells Ann N Y Acad Sci 872, 256 - 262 Gallacher, L., et al (2000); Identification of novel circulating human embryonic...

Ngày tải lên: 02/04/2014, 22:20

... populations Our approach points at understanding how individual agent dynamical behavior propagates to the population dynamics The presented concepts and mathematical tools are general enough and ... Utah, USA Makoto Kaneko, Hiroshima University, Japan Lydia Kavraki, Rice University, USA Sukhan Lee, Sungkyunkwan University, Korea Tim Salcudean, University of British Columbia, Canada Sebastian ... distance to obstacles The measurements are always positive and limited by some maximal distance If the maximal 1.1 Analogy Between an Individual Robot and a Cell distance is measured by a sensor,...

Ngày tải lên: 12/06/2014, 12:03

... M, Yanagisawa M, Toyama Y, Kawahara H, Watanabe M, Yoshida S, Kobayashi S, Yanaga K, Fujise K, Tajiri H: Streptococcal preparation OK-432 promotes fusion efficiency and enhances induction of antigenspecific ... cells as a vaccine for clinical use Gynecol Oncol 2005, 99:462-471 Koido S, Hara E, Torii A, Homma S, Toyama Y, Kawahara H, Ogawa M, Watanabe M, Yanaga K, Fujise K, Gong J, Toda G: Induction of antigen-specific ... and CEA By contrast, no lysis of allogeneic colorectal carcinoma cell line, COLM-6 (HLA -A2 - and A2 4-, WT1+ and CEA+) was observed, suggesting that HLA -A2 was, at least http://www.translational-medicine.com/content/6/1/51...

Ngày tải lên: 18/06/2014, 15:20

... advanced prostate cancer during vaccination The fall in PSA was at least 1.5% and upto 56% The average fall in PSA was 19% (Table 2) Disease stabilization occurred in a patient with colorectal ... 13:282-288 Iwamoto S, Iwai S-i, Tsujiyama K, Kurahashi C, Takeshita K, Naoe M, Masunaga A, Ogawa Y, Oguchi K, Miyazaki A: TNF-alpha drives human CD14+ monocytes to differentiate into CD70+ dendritic ... data MMA, AJM, NRH, JB, FF: preparation of the vaccine MMA, AJM, RAR, OE: critically drafting and reviewing the manuscript, including statistical analysis MMA, AJM, JME, ST: recruitment of patients...

Ngày tải lên: 18/06/2014, 15:20

... develop a therapeutic candidate that not only has a great potential for efficacy, but also can be easily implemented as part of the standard of care Our search led us to the area of low level laser ... surgery, activation of photodynamic agents, and various ablative therapies in cosmetics that are based on heat/tissue destruction generated by the laser beam [22-24] These applications of lasers are ... References Abdel-Latif A, Bolli R, Tleyjeh IM, Montori VM, Perin EC, Hornung CA, ZubaSurma EK, Al-Mallah M, Dawn B: Adult bone marrow-derived cells for cardiac repair: a systematic review and meta-analysis...

Ngày tải lên: 18/06/2014, 16:20