motion how should a premature contact in the molar dentition and an anterior openbite be managed
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
Ngày tải lên :
16/03/2014, 16:20
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... On one hand, structural data for the PA–substrate interactions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral intermediate in PA presents ... guanidinium fragments of ArgA145 and ArgB263 ˚ Table Distances (A) between polar substrates groups (CO2– and A NO2) and the two ArgB263 and ArgA145 residues of penicillin acylase as a result of AM1 optimization...
- 8
- 438
- 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx
Ngày tải lên :
29/03/2014, 21:20
... and the area dorsal to the substantia nigra in the midbrain reticular formation By immunostaining using monoclonal antibody against the N-terminus of the human relaxin-3 A- chain [2], relaxin-3-immunoreactive ... M Tanaka Relaxin-3 expression and function in the hypothalamus that relaxin-3 is abundant in the brain, but not in female reproductive tissue such as the ovary and uterus [1,6] By contrast, the ... 4995 Relaxin-3 expression and function in the hypothalamus M Tanaka 23 Miyamoto Y, Watanabe Y & Tanaka M (2008) Developmental expression and serotonergic regulation of relaxin ⁄ INSL7 in the nucleus...
- 8
- 369
- 0
HOW TO START A HEDGE FUND IN THE EU 2012 ppt
Ngày tải lên :
07/03/2014, 16:20
... is that we are seeing investors widen their investment mandates Managers have to be exactly in the investors’ mandate to have any chance of raising assets When those mandates are widening, in effect ... HFMWEEK ABOUT WHY START-UP MANAGERS NEED TO BE FLEXIBLE DURING UNCERTAIN TIMES A Ambasuthan Jananayagam is a partner at Point Nine Financial Technologies, an independent middle and back office ... business initially in Asia and then globally T he times they are a- changing”, to quote Bob Dylan, and never more so than in the financial sector After 2007’s crises (Lehman, Madhoff, Bear Stearns,...
- 24
- 545
- 0
how to get a higher ielts score by building a positive image in the examiner''''''''s mind
Ngày tải lên :
30/07/2014, 12:22
... can anxiety or panic be managed? Planning before writing Often candidates writing their answers almost immediately Because they are so scared of time begin in order to achieve the goals planning ... #5 We’ll take a look at how you can ‘sing and dance’ to the music of the Speaking test and how you can become a good ‘dance partner’ who impresses the assessor and makes a good ‘cooperative connection’ ... Why? The dance of the Speaking test – ‘It takes two to tango!’ How? • • • • As a dance partner you need to be responsive Finding an appropriate and active way of relating to the assessor For the...
- 65
- 433
- 0
Natural botanical products have a long history in the world and are featured in using a complex
Ngày tải lên :
03/11/2012, 09:54
... expressed as the number of apoptotic cells per field Statistical analysis Statistical significance between the treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), ... prostate cancer cell growth and induce apoptosis by inhibiting androgen receptor expression [1] Besides, soybeans contain various anti-carcinogenic compounds including lunasin and lectins that ... further examine the anti-tumor mechanism, the three important biological parameters in tumorigenesis including cell proliferation and apoptosis [7], and also angiogenesis [8] were assessed in gastric...
- 9
- 712
- 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên :
05/09/2013, 09:08
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... with official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use due ... RC associated with low imperviousness Many pollutant loading maps show transportation land use such as Los Angeles International Airport as the high pollutant emitting areas The pollutant loading...
- 7
- 575
- 0
The Importance of Eye Contact in the Classroom
Ngày tải lên :
06/09/2013, 10:10
... expression Show praise, encouragement often, and disapproval occasionally Remind learners that they ought to know an answer or that they could provide a response if they tried Use eye contact as a correction ... likely to seem transparently obvious, only natural, and an aspect of human behaviour either innate or developed over time But watch yourself, watch your colleagues, and watch your learners! ... make eye contact while they are working together in pairs or groups Start by training them to listen to each other using non-verbal responses only Research shows that there is a strong link between...
- 2
- 698
- 0
A study on oral presentation difficulties of second year english majors of phuong dong university in the speaking lessons and solutions
Ngày tải lên :
07/09/2013, 13:02
... Declaration I declare that this thesis is my own work and has not been submitted in any form for another degree or diploma at any university or other institution of tertiary education Information ... unclear pronunciation, their bad voice quality, lack of confidence all made it difficult for them to be understood Besides, the data from the study confirm the fact that the infrequent and inadequate ... study, finally, recommends that in order to improve the students’ presentation skills, students, teacher(s) and institution should make greater efforts in learning and teaching oral communication...
- 6
- 3.6K
- 99
How to improve peer interaction in the 10th form english class in high schools = làm thế nào để cải thiện sự tương tác giữa học sinh lớp 10 trong giờ học tiếng anh
Ngày tải lên :
18/12/2013, 21:39
... accomplish a learning task 1.2.2 Peer Interaction in Language Class 1.2.2.1 Communicative Language Teaching Communicative Language Teaching began in Britain in the late 1960s and has become the ... become the international language It is, hence, understandable why the demand of English learning is increasing considerably day by day Furthermore, the goal of the language learners has changed and ... citizens in Nghi Xuan have a beautiful tradition of caring about the youth's learning Thanks to the living standard improvement and care of family and society for learning, the students in Nghi Xuan...
- 30
- 760
- 3
Focus - A simplicity manifesto in the Age of Distraction
Ngày tải lên :
05/01/2014, 15:25
... many of the struggles we face these days, from being productive and achieving our goals, to getting healthy and fit in the face of fast food and inactivity, to finding simplicity and peace amidst ... In fact, it’s almost impossible to these things and create at the same time Sure, you can switch back and forth, so that you’re creating and engaging in any of these activities of consuming and ... to actually sit down and create Or stand up and create But create How to Beat Distraction, and Create If the problem is that these separate processes of creating, consuming and communicating...
- 121
- 552
- 1
A study on oral presentation difficulties of second year english majors of phuong dong university in the speaking lessons and solutions
Ngày tải lên :
29/01/2014, 10:43
... relevance and importance of the study, as well as to clarify any questions that the learners had 2.3 Data Analysis and Discussion of the Findings 2.3.1 Data Analysis 20 In order to interprete the ... presentation, (2) rewriting it for the ear, (3) practising and revising it, and (4) organizing the visual aids Once the learner has made an outline of the main points, write the presentation The main ... from the audience-this creates an active exchange between audience and speaker Be relaxed: Relaxation can help anxiety The presenter can choose to take a deep breathe or smile at the audience and...
- 45
- 3.3K
- 31
Tài liệu Mothers’ Investments in Child Health in the U.S. and U.K.: A Comparative Lens on the Immigrant ''Paradox'' docx
Ngày tải lên :
12/02/2014, 12:20
... Asia (India, Pakistan and Bangladesh), Africa and the Caribbean At the time of the 2001 Census, Indians were the largest minority group, followed by Pakistanis, Black Caribbeans, Black Africans ... mothers, for example, and below-average among Mexican, Cuban and Central/South American mothers (Landale, Oropesa and Gorman 1999) Evidence among non-Hispanic mothers and infants is less clear; ... immigrant mothers in the U.S and to white, South Asian, black African and Caribbean, and other (largely East Asian) immigrants in the U.K Studying mothers’ own behaviors provides a proximate assessment...
- 48
- 653
- 0
Tài liệu SOCIAL MEDIA AND BRAND AWARENESS - A CASE STUDY IN THE FAST MOVING CONSUMER GOODS SECTOR docx
Ngày tải lên :
18/02/2014, 08:20
... brands, and sub-brands These brands include a parent brand which may be a corporate brand, an umbrella brand, or a family brand as an endorsement to a sub-brand or an individual product brand The ... within branding to focus on The areas which will be looked into in this section besides brand and branding following right hereafter, are brand strategy, brand equity and brand awareness and managing ... media, social media and marketing, phases in the product life cycle in which social media may be used, social media and branding, brand and branding in general and branding in fast moving consumer...
- 54
- 684
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
Ngày tải lên :
21/02/2014, 01:21
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... nonsulfated glycosaminoglycans (GAGs) from the supernatant were estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the ... of the main peak obtained from AE-HPLC of WSM and EDTASM is given in Table These two peaks were characterized by a high content in glycine-alanine (31–30.6%) and serine As expected from an anion-exchange...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
Ngày tải lên :
21/02/2014, 03:20
... uncoupler- and oligomycin-sensitive and can be attributed to the ATP synthase This initial rate has been measured as a function of DpH in the presence and absence of Du for both mutant and wild-type ... (subunits a, c, b¢, b) leaving only a C-terminal truncated atpI gene (subunit i) After GTA transfer, kanamycin-resistant colonies appeared that could contain the kanamycin resistance cassette (i.e the ... chromatophores and standard protein in the different lanes of a single gel were kept in the linear range of the luminol assay response Light-induced ATP synthesis Light-driven ATP synthesis was carried...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
Ngày tải lên :
21/02/2014, 08:20
... beyond the Alameda, breaking open, as before, and examining all strong buildings on our route We had gone more than two blocks in advance of the Alameda, and were closely approaching the Main Plaza ... dismantling our own batteries, magazines, &c.; and aiding the Quartermaster's Department in landing and placing in depot the general engineer train of the army In the meantime, on the 7th of April, I reported, ... captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for more than a year My rank...
- 48
- 504
- 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
Ngày tải lên :
24/02/2014, 18:20
... Priscilla has conducted professional development for early years professionals in Australia, New Zealand, Thailand, England, Scotland, Northern Ireland and Ireland She is the author of many publications ... that print conveys meaning and make a connection between visual images, such as logos, and actions or meanings They are able to understand that the words have a structure and purpose, and they ... program that meets their needs and provides them with educational and social outcomes that assist them in attaining a high standard of education and a responsible life in the future Cultural and...
- 31
- 1K
- 2
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Ngày tải lên :
07/03/2014, 12:20
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ ... 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TAGGTACGGTCCATGC-3¢ 5¢-GCATGGATCGTACCTA-3¢ 5¢-GCATGGACCGTACCTA-3¢...
- 16
- 397
- 0