mood disorders and mother infant relationship the supportive role of a midwife
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The ... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate,...
- 8
- 551
- 0
Tài liệu Male Reproductive Health Disorders and the Potential Role of Exposure to Environmental Chemicals pdf
Ngày tải lên :
13/02/2014, 10:20
... estimates EU Country Lithuania Spain Estonia Latvia Italy Greece Finland Romania Bulgaria Malta Slovakia Poland Portugal Cyprus Ireland Belgium Hungary EU The Netherlands Sweden United Kingdom France ... TESTICULAR CANCER Western Africa Eastern Asia Middle Africa Northern Africa Melanesia Eastern Africa South-Central Asia Less developed regions Caribbean South-Eastern Asia Southern Africa Western Asia ... potential causes of cryptorchidism and hypospadias Quality assessment of the various studies and of the data obtained: The first major issue with both cryptorchidism and hypospadias is the accuracy...
- 56
- 500
- 0
Báo cáo y học: "Relationship among Dexamethasone Suppression Test, personality disorders and stressful life events in clinical subtypes of major depression: An exploratory study" pot
Ngày tải lên :
08/08/2014, 20:23
... International Personality Disorders Examination Geneva, ; 1995 Fountoulakis KN, Iacovides A, Ioannidou C, Bascialla F, Nimatoudis I, Kaprinis G, Janca A, Dahl A: Reliability and cultural applicability ... Scale (HDRS), the Hamilton Anxiety Scale (HAS), the 1965 and 1971 Newcastle Depression Diagnostic Scale (1965 and 1971-NDDS) and the Diagnostic Melancholia Scale (DMS) [15] and the General Assessment ... Associatrion: Diagnostic and Statistical Manual of Mental Disorders, 4th Edition DSM-IV Washington DC, American Psychiatric Press; 1994 WHO: The ICD-10 Classification of Mental and Behavioural...
- 8
- 415
- 0
Báo cáo y học: "PKC and PKA Phosphorylation Affect the Subcellular Localization of Claudin-1 in Melanoma Cells"
Ngày tải lên :
03/11/2012, 11:17
... R:5'-ccttggtgttgggtaagagtctgtttttcggggacaggaa-3' F:5'-actttgctgttcctgtccccgaaaagacgactcttacccaacaccaaggccc-3' R:5'-gggccttggtgttgggtaagagtcgtcttttcggggacaggaacagcaaagt-3' F:5'-aaaacaacctcttacccaacaccagacccctatccaaaacctgca-3' ... R:5'-gctgctcagattcagcaagtcgtcaaagactttgcactgg-3' F:5'-ctttgctgttcctgtccccgaaaagacacctcttacccaacacca-3' R:5'-tggtgttgggtaagaggtgtcttttcggggacaggaacagcaaag-3' F:5'-ttcctgtccccgaaaaacagactcttacccaacaccaagg-3' ... F:5'-gctgttcctgtccccgaaaaacagcctcttacccaa-3' R:5'-ttgggtaagaggctgtttttcggggacaggaacagc-3' PKA A5 68T _A5 71G F:5'-ctgttcctgtccccgaaaatcagcctcttacccaacac-3' R:5'-gtgttgggtaagaggctgattttcggggacaggaacag-3' F:5'-aacaacctcttacccaacaccagcgccctatccaaaacc-3'...
- 9
- 592
- 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"
Ngày tải lên :
03/11/2012, 11:35
... before treatment and at 10 days, and 6,9, and 24 months after treatment Surgical Technique After local anaesthesia, intrasulcular incisions were made at the buccal and lingual sides with Bard-Parker ... fact, the Hyaloss® matrix has a dual function: on one hand its physiochemical properties facilitate the application of bone graft in the damaged site and on the other hand, it creates an environment ... Pianigiani E, Andreassi A, Taddeucci P, Alessandrini C, Fimiani M, Andreassi L A new model for studying differentiation and growth of epidermal cultures on hyaluronan-based carrier Biomaterials...
- 7
- 769
- 0
Tài liệu Báo cáo khoa học: Oxidized elafin and trappin poorly inhibit the elastolytic activity of neutrophil elastase and proteinase 3 pdf
Ngày tải lên :
19/02/2014, 07:20
... obtain cDNAs encoding M25L–elafin and M63L–trappin For this purpose, forward primers 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ were used for amplification ... spectra of native and oxidized elafin (A) and trappin (B) The peaks at m ⁄ z ¼ 6000.975 and 9913.063 are assigned to the native inhibitors, whereas the peaks at m ⁄ z ¼ 6032.038 and 9948.639 are assigned ... wild-type elafin and trappin [15] Each of the molecules migrated as a single band at kDa (M25L–elafin) and 12 kDa (M63L–trappin) in a reducing SDS ⁄ PAGE gel, indicating homogeneity of each preparation...
- 11
- 548
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
Ngày tải lên :
19/02/2014, 16:20
... higher rates than usual radical rearrangements [98,312] On the other hand, the timing of radical rearrangement (radical clocks) may depend critically on the tightness of the radical cage and the ... [68], the enzyme variant still mediated N-oxygenation of the tertiary arylamine at a rate less than half that of the wild-type-catalyzed reaction [142], so that reasonable interpretation of the data ... permit the unmasking of radical intermediates that rearrange at a rate faster than that of the recombination step [16,93] Despite the apparent predominance of the hydrogen transfer mechanism as the...
- 26
- 746
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... structure of the protein Figure shows the fluorescence spectra of wild-type SNase and the four mutants E142O, K13 3A, W14 0A and W140O The fluorescence spectra of E142O and K13 3A are similar to that of the ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 ... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C and the theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease...
- 7
- 551
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... carried out using the CARA and ENCAD algorithms included in the GENEMINE program Bacterial strains and vectors The mutagenesis and expression phagemid, pGHX(–) was produced in our laboratory and...
- 12
- 740
- 0
THE FUNDAMENTAL ROLE OF SCIENCE AND TECHNOLOGYIN INTERNATIONAL DEVELOPMENT pptx
Ngày tải lên :
05/03/2014, 12:20
... with the Departments of State and Defense and other national and international organizations involved in reconstruction of war-torn areas, taking advantage of the technical capabilities of these ... countries of Africa, not have the human resources, physical and economic infrastructures, and access to capital to take full advantage of the S&T expertise and achievements of the United States and other ... United States GNI per Capita: http://www.worldbank.org/data/databytopic/GNIPC.pdf • Europe & Central Asia: Albania, Armenia, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Croatia, Czech...
- 163
- 440
- 0
Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt
Ngày tải lên :
07/03/2014, 02:20
... N-terminal 10 amino acids and no other part of Lsm8p, and shows nuclear accumulation, at least when tagged at the C-terminus (Fig 4B) Finally, nuclear localization of Lsm818–GFP and failure of Lsm181p ... formaldehyde or methanol) Intensities of nuclear and cytoplasmic signals were measured using IMAGEJ 1.38w and the average ratios of nuclear ⁄ cytoplasmic signals are indicated within each image ... for the former and a higher level of nuclear accumulation for the latter, indicating that in the absence of an N-terminal domain distinct localization is lacking Finally, the Lsm1p Sm domain...
- 16
- 515
- 0
Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of five novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx
Ngày tải lên :
07/03/2014, 11:20
... nitrogen and main and side-chain oxygen atoms of Ala59 and Glu61 of one subunit and with the main chain nitrogen of Asn114Â of the other subunit The contacts of the ribityl chain to His89 and Lys138Â ... images generated with the program pattern [32] The X-ray data were evaluated and scaled with the programs denzo and scalepack [31] Statistics of the data collection are given in Table The B-factors ... Northampton, MA, USA) as described earlier [13] All data were evaluated with the Microcal origin50 Software package (Microcal Software, INC., Northampton, MA, USA) The association constants, Ka,...
- 15
- 439
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... in the pH 4.2– 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the ... pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based on the...
- 10
- 651
- 0
Population Ageing, Elderly Welfare, and Extending Retirement Cover: The Case Study of Sri Lanka potx
Ngày tải lên :
14/03/2014, 17:20
... in an aggregate fall in savings, with attendant rises in the cost of capital (assuming unchanged demand for capital and constraints on capital inflows) and a dampening of investment demand and ... aimed at increasing the labour force participation rate of women The female participation rate is low (32%) in relation to per capita income and the educational attainment of women, and compares ... institutions: the Department of Census and Statistics, the Central Bank, and the Department of Pensions for making available their time and data I am also grateful to Dr Saman Kelegama (Executive Director,...
- 104
- 534
- 0
Dry mouth and its effects on the oral health of elderly people pptx
Ngày tải lên :
14/03/2014, 20:20
... irradiation and of the start of irradiation (after 10 grays of radiachemotherapy can cause or contribute to salivary tion have been delivered), a patient’s salivary gland diseases.1-3,5 Furthermore, ... accompanying infection A swollen parotid gland can displace the earlobe and extend inferiorly over the angle of the mandible, whereas an enlarged submandibular gland is palpated medial to the posteroinferior ... American Dental Association All rights reserved forms Patients with primary SS have salivary and lacrimal gland involvement, with an associated decreased production of saliva and tears In secondary...
- 6
- 716
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against...
- 18
- 494
- 0
Báo cáo khoa học: Tumour necrosis factor-a attenuates insulin action on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells pptx
Ngày tải lên :
16/03/2014, 02:20
... rRNA was taken as the internal loading control (A) Each band was analysed densitometrically and the values are depicted after normalization of PEPCK and G6Pase bands with those of 18S rRNA (B) ... triplicate and the data are presented as the mean ± standard error of the mean (SEM) Student’s t-test was used for statistical analysis and P < 0.05 was taken to be statistically significant Acknowledgements ... triplicate and the expression of each transcript was quantified by the relative standard curve method and normalized to that of 18S rRNA The transcript value for the control obtained after normalization...
- 13
- 449
- 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
Ngày tải lên :
16/03/2014, 05:20
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... culture tanks At 24, 48 and 72 h after injection, the hepatopancreas and ovary of the shrimp were dissected for total RNA preparation, and the hemolymph samples were collected for SDS ⁄ PAGE and western...
- 11
- 546
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
Ngày tải lên :
16/03/2014, 13:20
... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
- 14
- 390
- 0