molecule a protein associated with toll like receptor 4 on tlrs trafficking

Báo cáo y học: "Arthritis is associated with T-cell-induced upregulation of Toll-like receptor 3 on synovial fibroblasts" docx

Báo cáo y học: "Arthritis is associated with T-cell-induced upregulation of Toll-like receptor 3 on synovial fibroblasts" docx

... CACTCGAGGTAGGTGTTTCTGCTAA Forward GGGCAGCAGAAAGACGGTAT Reverse CAGGCACCAGCCATCCTTAA Forward AGAACCTTACTCATGTCCCAAAAGAC Reverse AGATCAGATATGGAGTTTTGAGACAGACT Forward tlr9 (rat) [NM_198131] ifn-b (rat) [NM_019127] ... GGCATAGCTGTTGTACTTCTTGTCTT Forward AAGAAAGACAAAGCCAGAGTC 263 60 CACAAACTGATATGCTTAGGC Forward ATCCCCTGATGTCCTCG 147 54 TTTCGCCAAAAGTGCC Forward TTCAACCCTGTTTACCT 293 54 TTCTTTTTCCTTGTCCC Forward GAGGGAAATCGTGCGTGAC 157 ... CAGCCCTAAGACAACAATACAATAGAAGA Forward CTCCTGTGAACTCCTGTCCTT Reverse AGCTGTCTGGCCAGTCAAC Forward GATTGGCAAGTTATTCGTC Reverse GCGGAGGCTGTTGTAGG Forward GATTGCTCAGACATGGCAGTTTC Reverse CACTCGAGGTAGGTGTTTCTGCTAA...

Ngày tải lên: 12/08/2014, 17:22

15 326 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

... cDNA sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically ... compared with sham controls Mechanical allodynia and thermal hyperalgesia induced by CCI was attenuated by intrathecal administration with TLR4-siRNA (p

Ngày tải lên: 25/10/2012, 11:48

9 487 0
Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx

Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx

... 13, 46 0 46 9 28 Sato S, Sugiyama M, Yamamoto M, Watanabe Y, Kawai T, Takeda K & Akira S (2003) Toll ⁄ IL-1 receptor domain-containing adaptor inducing IFN-b (TRIF) associates with TNF receptor -associated ... RelA nuclear translocation (Fig S4B, lane versus lane 4) From these results, we postulate that the polyN-acetyllactosaminic carbohydrate moiety may act as a moderate activator of TLR4 Discussion ... Technology (Danvers, MA, USA) The TNF -a Human Biotrak Easy ELISA kit was obtained from GE Healthcare BioSciences KK, Japan Actinase E was obtained from KakenSeiyaku Co., Japan Endo-b-galactosidase (EC...

Ngày tải lên: 06/03/2014, 11:20

16 456 0
Báo cáo y học: "Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet''''s disease" potx

Báo cáo y học: "Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet''''s disease" potx

... Sense CAGGCAGAGAATGCTGAG Antisense GCTTCACATAGCGCTGCA Sense TGACTGCTCGGAGTTCTCCC Antisense GTCAGCACCAGAGCCTGGAG Sense GCGGCTCGAGGAAGAGAAGA Antisense AGGCTCTGATATGCCCCATC Sense ACAGTCAGCCGCATC Antisense ... AGGTGCGGCTCCCTA Sense ATGAGCACTGAAAGCATGATC Antisense GGCGATGCGGCTGATGGT Sense CGGCCGAAGAGTTCACAAGT Antisense AGTGCAGTCCTGTGGCTTC Sense TAAATCTTTTCTGCTTACTGA Antisense TACTCAATTTATTCTAATTTGAAT ... membrane was incubated with optimally diluted anti-HO-1 monoclonal antibody (Stressgen), anti-TLR2 and anti-TLR4 (Imgenex, San Diego, CA, USA) monoclonal antibody, or antiactin goat polyclonal antibody...

Ngày tải lên: 09/08/2014, 10:22

10 355 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

... 1 74: 5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/ NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll- like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with...

Ngày tải lên: 11/08/2014, 03:20

7 272 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

... 1 74: 5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/ NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll- like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with...

Ngày tải lên: 11/08/2014, 06:22

7 238 0
Báo cáo y học: "A novel model of common Toll-like receptor 4- and injury-induced transcriptional themes in human leukocytes" pot

Báo cáo y học: "A novel model of common Toll-like receptor 4- and injury-induced transcriptional themes in human leukocytes" pot

... the sleep/wake and circadian cycles Chronobiol Int 2007, 24: 1009-10 34 43 Takimoto M, Hamada A, Tomoda A, Ohdo S, Ohmura T, Sakato H, Kawatani J, Jodoi T, Nakagawa H, Terazono H, Koyanagi S, Higuchi ... inflammation and in trauma patients studied over a to 12 day period after ICU admission • The group includes genes associated with translation and glycolysis • Several additional genes associated ... et al Critical Care 2010, 14: R177 http://ccforum.com/content/ 14/ 5/R177 synthesis pathways Two additional pathways, a lipid metabolism pathway, and a cellular assembly and organization pathway,...

Ngày tải lên: 13/08/2014, 21:21

11 252 0
Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt

Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt

... transgenic mice Circulation 112, 2668–2676 Kuwano Y, Kawahara T, Yamamoto H, TeshimaKondo S, Tominaga K, Masuda K, Kishi K, Morita K & Rokutan K (2006) Interferon-gamma activates transcription ... of NADPH-oxidase in cerebral vascular control Pharmacol Ther 111, 928– 948 11 Csanyi G, Taylor WR & Pagano PJ (2009) NOX and inflammation in the vascular adventitia Free Radic Biol Med 47 , 12 54 1266 ... Nature 40 1, 79–82 Rokutan K, Kawahara T, Kuwano Y, Tominaga K, Sekiyama A & Teshima-Kondo S (2006) NADPH oxidases in the gastrointestinal tract: a potential role of Nox1 in innate immune response...

Ngày tải lên: 22/03/2014, 21:21

8 340 0
Báo cáo hóa học: " Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4" potx

Báo cáo hóa học: " Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4" potx

... TLR4 (5’-GATCCCGTATTAGGAACTACCTCTATGCTTGATATC CGGCATAGAGGTAGTTCCTAATATTTTTTCCAAA-3’ and 5’-AGCTTTTGGAAAAA ATATTAGG AACTACCTCTATGCCGGATATCAAGCATAGAGGTAGTTCCTAATA CGG-3’; 5’-GATCCCGTTGAAAC TGCAATCAAGAGTGTTGATATCCGCACTCTTG ... TGCAATCAAGAGTGTTGATATCCGCACTCTTG ATTGCAGTTTCAATTTTTTCCAAA-3’and 5’-AGCT Page of TTTGGAAAAAATTGAAACT GCAATCAAGAGTGCGGATATCAACACTCTTGATTGCAGTTTCAACGG-3’; 5’-GATCCCATTCGCCAAGCAATGGAAC TTGATATCCGGTTCCATTGCTTGGCGAA ... TTGATATCCGGTTCCATTGCTTGGCGAA TTTTT TTCCAAA-3’and 5’-AGCTTTTGGAAAAAAATTCGCCAAGCAATGGAACCG GATATCAAGTTCCATTGCT TGGCGAATGG-3’) were synthesized and annealed A TLR4-siRNA expression vector that expresses hairpin shRNA under...

Ngày tải lên: 18/06/2014, 16:20

8 489 0
Báo cáo sinh học: " Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" potx

Báo cáo sinh học: " Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" potx

... 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C, 38 cycles of DNA amplification were performed using Taq DNA Polymerase 2× Master ... observations of Pandey et al., who reported a significant association of this genotype with cervical cancer at an early stage [ 24] The impact of conventional anticancer chemotherapy not only affects ... heterozygous variant) had no impact on this observation TLR4 Genotype and Disease Advancement Our analysis revealed a significant association between TLR4 Asp299Gly genotype and recurrence of disease with...

Ngày tải lên: 18/06/2014, 22:20

9 336 0
báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx

báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx

... intestinal decontamination suggest a pivotal role for anaerobic Gram-negative bacteria translocation on TLR4-signaling pathway activation after stress exposure in brain cortex of rats In accordance with ... CAC AAC AGA G-3’, and reverse: 5’-GCG GAT GCC AGT GAT AGA G-3’, for TLR4, forward: 5’-AGT TGG CTC TGC CAA GTC TCA GAT- 3’, reverse: 5’-TGG CAC TCA TCA GGA TGA CAC CAT-3’, for MD-2 forward: 5’-CAT ... contributed to analysis and interpretation of data and revising the manuscript critically; LB and EB contributed to acquisition, analysis and interpretation of CMS model and behavioural data; JAM and JRC...

Ngày tải lên: 19/06/2014, 22:20

14 422 0
báo cáo hóa học:" Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" doc

báo cáo hóa học:" Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" doc

... 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C, 38 cycles of DNA amplification were performed using Taq DNA Polymerase 2× Master ... observations of Pandey et al., who reported a significant association of this genotype with cervical cancer at an early stage [ 24] The impact of conventional anticancer chemotherapy not only affects ... heterozygous variant) had no impact on this observation TLR4 Genotype and Disease Advancement Our analysis revealed a significant association between TLR4 Asp299Gly genotype and recurrence of disease with...

Ngày tải lên: 20/06/2014, 04:20

9 418 0
Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-B pathway doc

Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-B pathway doc

... in comparative cardiovascular pathology Cardiovasc Res 2007, 73:26-36 Kuwahara F, Kai H, Tokuda K, Niiyama H, Tahara N, Kusaba K, Takemiya K, Jalalidin A, Koga M, Nagata T, Shibata R, Imaizumi ... manuscript B-WW has made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data C-ML has made substantial contributions to conception and design, ... genomic DNA was amplified with forward primer, ACGCGTCCCCATGAACAAAC and reverse primer, AGATCTGGAACAATGCCATG The amplified product was digested with MluI and BglII restriction enzymes and ligated...

Ngày tải lên: 10/08/2014, 05:21

13 289 0
Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot

Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot

... antisense, 5′→3′ TLR1 AGCAAAGAAATAGATTACACATCA TTACCTACATCATACACTCACAAT TLR2 GCAAGCTGCGGAAGATAATG CGCAGCTCTCAGATTTACCC TLR3 GAATGTTTAAATCTCACTGC AAGTGCTACTTGCAATTTAT TLR4 ATGAAATGAGTTGCAGCAGA ... ATGAAATGAGTTGCAGCAGA AGCCATCGTTGTCTCCCTAA TLR5 GTACAGAAACAGCAGTATTTGAG TCTGTTGAGAGAGTTTATGAAGAA TLR6 TTTACTTGGATGATGATGAATAGT AGTTCCCCAGATGAAACATT TLR7 TLR8 CCATACTTCTGGCAGTGTCT AAGAGCTCCATCCTCCAGTG ACTAGGCAGTTGTGTTTTGC ... CCGTGAATCATTTTCAGTCAA TLR9 GGGACAACCACCACTTCTAT TGAGGTGAGTGTGGAGGT TLR10 CAACGATAGGCGTAAATGTG GAACCTCGAGACTCTTCATTT TNF -a CTCCACCCATGTGCTCCTCA CTCTGGCAGGGGCTCTTGAT IL10 CAACAGAAGCTTCCATTCCA AGCAGT...

Ngày tải lên: 12/08/2014, 11:22

15 375 0
Báo cáo y học: "Toll-like receptor-4 mediates cigarette smoke-induced cytokine production by human macrophages" pptx

Báo cáo y học: "Toll-like receptor-4 mediates cigarette smoke-induced cytokine production by human macrophages" pptx

... spectrophotometrically and the media was standardized to a standard curve of CS medium concentration against absorbance at 320 nm This concentration was serially diluted with untreated media and applied to the cells ... medium-induced signaling pathways in human monocyte-derived macrophages are IRAK and TRF6 mediated In the TLR-mediated signaling pathways, IRAKs and TRAF6 play critical roles, as demonstrated by analysis ... activation and signals via IRAK and TRAF [29,30] Our observations show that the signaling cascade of TLR4 ligation by CS medium involves IRAK-1 phosphorylation (Figure 4A) Additionally, we found that...

Ngày tải lên: 12/08/2014, 16:20

11 311 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

... et al., 1997) TAK1 also activates the p38, JNK and p42/p 44 MAPK signaling pathways p38 in turn activates the transcription factor activation protein (AP-1) (Johnson and Lapadat, 2002) A second ... galactose utilization GAL4 contains a DNA binding domain (BD) (Keegan et al., 1986) and a transcription activation domain (AD) (Brent and Ptashne, 1985) which are separately folded and functions ... close association In the MyD88/IRAK1/IRAK4 complex, activated IRAK4 phosphorylates IRAK1 to activate the kinase activity of IRAK1, leading to IRAK4 phosphorylation IRAK -4 is a central molecule...

Ngày tải lên: 12/09/2015, 08:20

236 494 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... 1¢ 2 44 4A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + ... codon Two putative polyadenylation signals (AATAAG and AATAAC) are present about 20 nucleotides in front of the poly (A) tail (Fig 3A) Both are not identical to the most often used signal AAT AAA ... 2 14 nucleotides Especially exons 1¢, 4 and have a high G ⁄ C content (Table 2) Upstream ATG codons are found in exons 1, 2, 3, 4 and 4, but only those in exons 3, 4 and are located in an adequate...

Ngày tải lên: 19/02/2014, 17:20

9 518 0
Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

... TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTGCCTGAGTATC - 3¢ (antisense), IL-8 5¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense) FEBS Journal ... signal transduction The LPS signalling cascade involves a lot of adapter molecules, such as MyD88 [7] and Toll receptor IL-1R domain-containing adapter protein (TIRAP) ⁄ MyD88 adapter -like (Mal) ... RSCL- 040 9 blocks nuclear translocation of NF-jB and activation of NF-jB transcription factor LPS, together with a range of inflammatory stimuli, activates and induces nuclear translocation of...

Ngày tải lên: 22/03/2014, 21:20

14 202 0
Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

... Mukaiyama et al B BSA holo-NPAS2 ∆ F (Hz) holo-NPAS2 holo-NPAS2 holo-NPAS2 holo-NPAS2 a p o- N PAS apo-NPAS2 apo-NPAS2 apo-NPAS2 BSA apo-NPAS2 ∆ F (Hz) A Characterization of bHLH-PAS -A of NPAS2 ... bHLH-PAS -A of NPAS2 Y Mukaiyama et al Table Resonance Raman spectra of Fe(II)–CO complexes of the basic helix–loop–helix (bHLH)-PAS -A and PAS -A domains of neuronal PAS domain protein bHLH-PAS -A PAS -A ... the apo-bHLH-PAS -A domain was composed of only a single phase (Fig 7A, inset), and the rate of association was dependent on the apoprotein concentration (Fig 7C) As summarized in Table 4, the rate...

Ngày tải lên: 30/03/2014, 11:20

12 360 0
báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

... mAb and has shown early clinical promise in phase I trials, particularly in patients with advanced melanoma [ 14] Little direct evidence is available regarding its mechanism of action and in particular, ... 2008, 14: 4532 -45 42 Ruprecht CR, Lanzavecchia A: Toll- like receptor stimulation as a third signal required for activation of human naive B cells Eur J Immunol 2006, 36:810-816 Clatworthy MR, Watson ... signal-transduction activity and mediates its effects via downstream adapter molecules that regulate gene expression CD40-ligand (CD40L), also known as CD1 54, is the chief ligand for CD40 and...

Ngày tải lên: 18/06/2014, 15:20

10 624 0
w