0

molecule a protein associated with toll like receptor 4 on tlrs trafficking

Báo cáo y học:

Báo cáo y học: "Arthritis is associated with T-cell-induced upregulation of Toll-like receptor 3 on synovial fibroblasts" docx

Báo cáo khoa học

... CACTCGAGGTAGGTGTTTCTGCTAA Forward GGGCAGCAGAAAGACGGTAT Reverse CAGGCACCAGCCATCCTTAA Forward AGAACCTTACTCATGTCCCAAAAGAC Reverse AGATCAGATATGGAGTTTTGAGACAGACT Forward tlr9 (rat) [NM_198131] ifn-b (rat) [NM_019127] ... GGCATAGCTGTTGTACTTCTTGTCTT Forward AAGAAAGACAAAGCCAGAGTC 263 60 CACAAACTGATATGCTTAGGC Forward ATCCCCTGATGTCCTCG 147 54 TTTCGCCAAAAGTGCC Forward TTCAACCCTGTTTACCT 293 54 TTCTTTTTCCTTGTCCC Forward GAGGGAAATCGTGCGTGAC 157 ... CAGCCCTAAGACAACAATACAATAGAAGA Forward CTCCTGTGAACTCCTGTCCTT Reverse AGCTGTCTGGCCAGTCAAC Forward GATTGGCAAGTTATTCGTC Reverse GCGGAGGCTGTTGTAGG Forward GATTGCTCAGACATGGCAGTTTC Reverse CACTCGAGGTAGGTGTTTCTGCTAA...
  • 15
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"

Y học thưởng thức

... cDNA sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically ... compared with sham controls Mechanical allodynia and thermal hyperalgesia induced by CCI was attenuated by intrathecal administration with TLR4-siRNA (p
  • 9
  • 487
  • 0
Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx

Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx

Báo cáo khoa học

... 13, 46 0 46 9 28 Sato S, Sugiyama M, Yamamoto M, Watanabe Y, Kawai T, Takeda K & Akira S (2003) Toll ⁄ IL-1 receptor domain-containing adaptor inducing IFN-b (TRIF) associates with TNF receptor -associated ... RelA nuclear translocation (Fig S4B, lane versus lane 4) From these results, we postulate that the polyN-acetyllactosaminic carbohydrate moiety may act as a moderate activator of TLR4 Discussion ... Technology (Danvers, MA, USA) The TNF -a Human Biotrak Easy ELISA kit was obtained from GE Healthcare BioSciences KK, Japan Actinase E was obtained from KakenSeiyaku Co., Japan Endo-b-galactosidase (EC...
  • 16
  • 456
  • 0
Báo cáo y học:

Báo cáo y học: "Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet''''s disease" potx

Báo cáo khoa học

... Sense CAGGCAGAGAATGCTGAG Antisense GCTTCACATAGCGCTGCA Sense TGACTGCTCGGAGTTCTCCC Antisense GTCAGCACCAGAGCCTGGAG Sense GCGGCTCGAGGAAGAGAAGA Antisense AGGCTCTGATATGCCCCATC Sense ACAGTCAGCCGCATC Antisense ... AGGTGCGGCTCCCTA Sense ATGAGCACTGAAAGCATGATC Antisense GGCGATGCGGCTGATGGT Sense CGGCCGAAGAGTTCACAAGT Antisense AGTGCAGTCCTGTGGCTTC Sense TAAATCTTTTCTGCTTACTGA Antisense TACTCAATTTATTCTAATTTGAAT ... membrane was incubated with optimally diluted anti-HO-1 monoclonal antibody (Stressgen), anti-TLR2 and anti-TLR4 (Imgenex, San Diego, CA, USA) monoclonal antibody, or antiactin goat polyclonal antibody...
  • 10
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Báo cáo khoa học

... 1 74: 5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/ NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll- like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with...
  • 7
  • 272
  • 0
Báo cáo y học:

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Báo cáo khoa học

... 1 74: 5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/ NF- kappa B pathway in saturated ... Takeda K, Kaisho T, Akira S: Toll- like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi ... hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty acids act as agonist for TLR4 and therefore linking dietary fat with...
  • 7
  • 238
  • 0
Báo cáo y học:

Báo cáo y học: "A novel model of common Toll-like receptor 4- and injury-induced transcriptional themes in human leukocytes" pot

Báo cáo khoa học

... the sleep/wake and circadian cycles Chronobiol Int 2007, 24: 1009-10 34 43 Takimoto M, Hamada A, Tomoda A, Ohdo S, Ohmura T, Sakato H, Kawatani J, Jodoi T, Nakagawa H, Terazono H, Koyanagi S, Higuchi ... inflammation and in trauma patients studied over a to 12 day period after ICU admission • The group includes genes associated with translation and glycolysis • Several additional genes associated ... et al Critical Care 2010, 14: R177 http://ccforum.com/content/ 14/ 5/R177 synthesis pathways Two additional pathways, a lipid metabolism pathway, and a cellular assembly and organization pathway,...
  • 11
  • 252
  • 0
Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt

Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt

Báo cáo khoa học

... transgenic mice Circulation 112, 2668–2676 Kuwano Y, Kawahara T, Yamamoto H, TeshimaKondo S, Tominaga K, Masuda K, Kishi K, Morita K & Rokutan K (2006) Interferon-gamma activates transcription ... of NADPH-oxidase in cerebral vascular control Pharmacol Ther 111, 928– 948 11 Csanyi G, Taylor WR & Pagano PJ (2009) NOX and inflammation in the vascular adventitia Free Radic Biol Med 47 , 12 54 1266 ... Nature 40 1, 79–82 Rokutan K, Kawahara T, Kuwano Y, Tominaga K, Sekiyama A & Teshima-Kondo S (2006) NADPH oxidases in the gastrointestinal tract: a potential role of Nox1 in innate immune response...
  • 8
  • 340
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Prevention of hyperglycemia-induced myocardial apoptosis by gene silencing of Toll-like receptor-4" potx

Hóa học - Dầu khí

... TLR4 (5’-GATCCCGTATTAGGAACTACCTCTATGCTTGATATC CGGCATAGAGGTAGTTCCTAATATTTTTTCCAAA-3’ and 5’-AGCTTTTGGAAAAA ATATTAGG AACTACCTCTATGCCGGATATCAAGCATAGAGGTAGTTCCTAATA CGG-3’; 5’-GATCCCGTTGAAAC TGCAATCAAGAGTGTTGATATCCGCACTCTTG ... TGCAATCAAGAGTGTTGATATCCGCACTCTTG ATTGCAGTTTCAATTTTTTCCAAA-3’and 5’-AGCT Page of TTTGGAAAAAATTGAAACT GCAATCAAGAGTGCGGATATCAACACTCTTGATTGCAGTTTCAACGG-3’; 5’-GATCCCATTCGCCAAGCAATGGAAC TTGATATCCGGTTCCATTGCTTGGCGAA ... TTGATATCCGGTTCCATTGCTTGGCGAA TTTTT TTCCAAA-3’and 5’-AGCTTTTGGAAAAAAATTCGCCAAGCAATGGAACCG GATATCAAGTTCCATTGCT TGGCGAATGG-3’) were synthesized and annealed A TLR4-siRNA expression vector that expresses hairpin shRNA under...
  • 8
  • 488
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" potx

Điện - Điện tử

... 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C, 38 cycles of DNA amplification were performed using Taq DNA Polymerase 2× Master ... observations of Pandey et al., who reported a significant association of this genotype with cervical cancer at an early stage [ 24] The impact of conventional anticancer chemotherapy not only affects ... heterozygous variant) had no impact on this observation TLR4 Genotype and Disease Advancement Our analysis revealed a significant association between TLR4 Asp299Gly genotype and recurrence of disease with...
  • 9
  • 335
  • 0
báo cáo hóa học:

báo cáo hóa học: " Origin and consequences of brain Toll-like receptor 4 pathway stimulation in an experimental model of depression" docx

Toán học

... intestinal decontamination suggest a pivotal role for anaerobic Gram-negative bacteria translocation on TLR4-signaling pathway activation after stress exposure in brain cortex of rats In accordance with ... CAC AAC AGA G-3’, and reverse: 5’-GCG GAT GCC AGT GAT AGA G-3’, for TLR4, forward: 5’-AGT TGG CTC TGC CAA GTC TCA GAT- 3’, reverse: 5’-TGG CAC TCA TCA GGA TGA CAC CAT-3’, for MD-2 forward: 5’-CAT ... contributed to analysis and interpretation of data and revising the manuscript critically; LB and EB contributed to acquisition, analysis and interpretation of CMS model and behavioural data; JAM and JRC...
  • 14
  • 422
  • 0
báo cáo hóa học:

báo cáo hóa học:" Toll-like receptor 4 single-nucleotide polymorphisms Asp299Gly and Thr399Ile in head and neck squamous cell carcinomas" doc

Hóa học - Dầu khí

... 5’-CTA CCA AGC CTT GAG TTT CTA G-3’ and the reverse primer 5’-AAG CTC AGA TCT AAA TAC CT-3’ After denaturation at 95°C, 38 cycles of DNA amplification were performed using Taq DNA Polymerase 2× Master ... observations of Pandey et al., who reported a significant association of this genotype with cervical cancer at an early stage [ 24] The impact of conventional anticancer chemotherapy not only affects ... heterozygous variant) had no impact on this observation TLR4 Genotype and Disease Advancement Our analysis revealed a significant association between TLR4 Asp299Gly genotype and recurrence of disease with...
  • 9
  • 417
  • 0
Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-B pathway doc

Cyclic stretch enhances the expression of Toll-like Receptor 4 gene in cultured cardiomyocytes via p38 MAP kinase and NF-B pathway doc

Báo cáo khoa học

... in comparative cardiovascular pathology Cardiovasc Res 2007, 73:26-36 Kuwahara F, Kai H, Tokuda K, Niiyama H, Tahara N, Kusaba K, Takemiya K, Jalalidin A, Koga M, Nagata T, Shibata R, Imaizumi ... manuscript B-WW has made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data C-ML has made substantial contributions to conception and design, ... genomic DNA was amplified with forward primer, ACGCGTCCCCATGAACAAAC and reverse primer, AGATCTGGAACAATGCCATG The amplified product was digested with MluI and BglII restriction enzymes and ligated...
  • 13
  • 289
  • 0
Báo cáo y học:

Báo cáo y học: " Differential cell reaction upon Toll-like receptor 4 and 9 activation in human alveolar and lung interstitial macrophages" pot

Báo cáo khoa học

... antisense, 5′→3′ TLR1 AGCAAAGAAATAGATTACACATCA TTACCTACATCATACACTCACAAT TLR2 GCAAGCTGCGGAAGATAATG CGCAGCTCTCAGATTTACCC TLR3 GAATGTTTAAATCTCACTGC AAGTGCTACTTGCAATTTAT TLR4 ATGAAATGAGTTGCAGCAGA ... ATGAAATGAGTTGCAGCAGA AGCCATCGTTGTCTCCCTAA TLR5 GTACAGAAACAGCAGTATTTGAG TCTGTTGAGAGAGTTTATGAAGAA TLR6 TTTACTTGGATGATGATGAATAGT AGTTCCCCAGATGAAACATT TLR7 TLR8 CCATACTTCTGGCAGTGTCT AAGAGCTCCATCCTCCAGTG ACTAGGCAGTTGTGTTTTGC ... CCGTGAATCATTTTCAGTCAA TLR9 GGGACAACCACCACTTCTAT TGAGGTGAGTGTGGAGGT TLR10 CAACGATAGGCGTAAATGTG GAACCTCGAGACTCTTCATTT TNF -a CTCCACCCATGTGCTCCTCA CTCTGGCAGGGGCTCTTGAT IL10 CAACAGAAGCTTCCATTCCA AGCAGT...
  • 15
  • 375
  • 0
Báo cáo y học:

Báo cáo y học: "Toll-like receptor-4 mediates cigarette smoke-induced cytokine production by human macrophages" pptx

Báo cáo khoa học

... spectrophotometrically and the media was standardized to a standard curve of CS medium concentration against absorbance at 320 nm This concentration was serially diluted with untreated media and applied to the cells ... medium-induced signaling pathways in human monocyte-derived macrophages are IRAK and TRF6 mediated In the TLR-mediated signaling pathways, IRAKs and TRAF6 play critical roles, as demonstrated by analysis ... activation and signals via IRAK and TRAF [29,30] Our observations show that the signaling cascade of TLR4 ligation by CS medium involves IRAK-1 phosphorylation (Figure 4A) Additionally, we found that...
  • 11
  • 311
  • 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Cao đẳng - Đại học

... et al., 1997) TAK1 also activates the p38, JNK and p42/p 44 MAPK signaling pathways p38 in turn activates the transcription factor activation protein (AP-1) (Johnson and Lapadat, 2002) A second ... galactose utilization GAL4 contains a DNA binding domain (BD) (Keegan et al., 1986) and a transcription activation domain (AD) (Brent and Ptashne, 1985) which are separately folded and functions ... close association In the MyD88/IRAK1/IRAK4 complex, activated IRAK4 phosphorylates IRAK1 to activate the kinase activity of IRAK1, leading to IRAK4 phosphorylation IRAK -4 is a central molecule...
  • 236
  • 494
  • 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Báo cáo khoa học

... 1¢ 2 44 4A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + ... codon Two putative polyadenylation signals (AATAAG and AATAAC) are present about 20 nucleotides in front of the poly (A) tail (Fig 3A) Both are not identical to the most often used signal AAT AAA ... 2 14 nucleotides Especially exons 1¢, 4 and have a high G ⁄ C content (Table 2) Upstream ATG codons are found in exons 1, 2, 3, 4 and 4, but only those in exons 3, 4 and are located in an adequate...
  • 9
  • 518
  • 0
Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

Báo cáo khoa học: Novel synthetic gluco-disaccharide RSCL-0409 – a lipopolysaccharide-induced Toll-like receptor-mediated signalling antagonist doc

Báo cáo khoa học

... TCCAGTTCAGTGCGGCACGAGAA - 3¢ (antisense) Cox-2 5¢-ATGAGATTGTGGGAAAATTGCT- 3¢ (sense) 5¢- GGTAGATCATCTCTGCCTGAGTATC - 3¢ (antisense), IL-8 5¢- GCCAAGGAGTGCTAAAGAACTTAG -3¢ (sense) FEBS Journal ... signal transduction The LPS signalling cascade involves a lot of adapter molecules, such as MyD88 [7] and Toll receptor IL-1R domain-containing adapter protein (TIRAP) ⁄ MyD88 adapter -like (Mal) ... RSCL- 040 9 blocks nuclear translocation of NF-jB and activation of NF-jB transcription factor LPS, together with a range of inflammatory stimuli, activates and induces nuclear translocation of...
  • 14
  • 202
  • 0
Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Báo cáo khoa học: Spectroscopic and DNA-binding characterization of the isolated heme-bound basic helix–loop–helix-PAS-A domain of neuronal PAS protein 2 (NPAS2), a transcription activator protein associated with circadian rhythms docx

Báo cáo khoa học

... Mukaiyama et al B BSA holo-NPAS2 ∆ F (Hz) holo-NPAS2 holo-NPAS2 holo-NPAS2 holo-NPAS2 a p o- N PAS apo-NPAS2 apo-NPAS2 apo-NPAS2 BSA apo-NPAS2 ∆ F (Hz) A Characterization of bHLH-PAS -A of NPAS2 ... bHLH-PAS -A of NPAS2 Y Mukaiyama et al Table Resonance Raman spectra of Fe(II)–CO complexes of the basic helix–loop–helix (bHLH)-PAS -A and PAS -A domains of neuronal PAS domain protein bHLH-PAS -A PAS -A ... the apo-bHLH-PAS -A domain was composed of only a single phase (Fig 7A, inset), and the rate of association was dependent on the apoprotein concentration (Fig 7C) As summarized in Table 4, the rate...
  • 12
  • 360
  • 0
báo cáo hóa học:

báo cáo hóa học:" Activation of human B cells by the agonist CD40 antibody CP-870,893 and augmentation with simultaneous toll-like receptor 9 stimulation" doc

Hóa học - Dầu khí

... mAb and has shown early clinical promise in phase I trials, particularly in patients with advanced melanoma [ 14] Little direct evidence is available regarding its mechanism of action and in particular, ... 2008, 14: 4532 -45 42 Ruprecht CR, Lanzavecchia A: Toll- like receptor stimulation as a third signal required for activation of human naive B cells Eur J Immunol 2006, 36:810-816 Clatworthy MR, Watson ... signal-transduction activity and mediates its effects via downstream adapter molecules that regulate gene expression CD40-ligand (CD40L), also known as CD1 54, is the chief ligand for CD40 and...
  • 10
  • 624
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25