molecular aspects of steroid receptor dna binding

... feature of chemokines is the redundancy of the system Several chemokines bind to more than one receptor, and the majority of chemokine receptors have multiple ligands, leading to the generation of ... release of mediators of inflammation, cell proliferation and angiogenesis To date, several animal studies and human studies have shown the biological efficacy of specific antagonism of ligands and receptors ... the dominant source of MCP-1 ⁄ CCL2 production [19] The levels of MCP-1 ⁄ CCL2 correlate significantly with the levels of IL-1b, IL-6 and IL-8 ⁄ CXCL8 in culture supernatants of synovium from RA...

Ngày tải lên: 18/02/2014, 18:20

... amplification of both NS1 and VP genes of B19 DNA in synovial membranes has revealed that the levels of B19 DNA are similar in RA and control synovial membranes [11] Thus, the contribution of B19 infection ... [7] A recent report showed evidence of the high prevalence of B19 DNA in patients with RA [8] However, a significant amount of evidence contradicts a role of B19 infection in RA pathogenesis For ... reported that human retrovirus proviral DNA was detected in 53% of synovial samples from arthritic joints, in 12% of blood samples from RA patients and in 16% of blood samples from patients with...

Ngày tải lên: 18/02/2014, 18:20

... repeat of the nuclear receptor hexameric DNA core recognition motif spaced by one nucleotide In addition to the regulation of gene transcription via PPREs, PPARs modulate gene expression in a DNA- binding- independent ... etc (Fig 3) Ligand binding of various receptors results in the activation of phospholipase C (PLC), the release of inositol 1,4,5-triphosphate (IP3), and a transient release of Ca2+ from intracellular ... proliferator-activated receptors heterodimerize with the retinoid X receptor and regulate transcription of target genes through binding to specific peroxisome proliferator response elements (PPREs), which consist of...

Ngày tải lên: 18/02/2014, 18:20

... overexpression of ORP2 led to a significant reduction of ACAT activity and cholesterol esters [8] Overexpression of a splice variant of ORP4 (ORP4-S) caused a 40% reduction in esterification of low density ... processed to its mature form (M form with molecular mass of 61 kDa) Deficiency in this process leads to accumulation of and secretion of p2 CPY As shown in Fig 7, at of chase, p1 CPY was the predominant ... in the absence of Osh6p or the presence of a high level of Osh6p The discrepancy may be due to the fact that a more drastic disruption of sterol homeostasis is incurred upon loss of all Osh function...

Ngày tải lên: 07/03/2014, 21:20

... flexible in the absence of DNA and not very clearly defined in the X-ray picture of the protein (Fig 1) We report here the results of an extensive thermalstability study of a hyperthermophilic ... dependence of the heat capacity of the initial and final conformations (Cp,N2 and Cp,U), the heat capacity of the native state was taken to be a linear function of temperature and that of the unfolded ... effect of the co-operative unfolding Nevertheless, elimination of the contribution of residues 52–86 (the positions of which are not defined by X-ray crystallography in HUTmar) to the molecular...

Ngày tải lên: 23/03/2014, 12:20

... by cAMP binding to the anti-cAMP -binding sites of CRP, which in turn trigger specic pathways of signal transmission from the cyclic nucleotide -binding domain to the DNA- binding domain of the protein ... by about A to 18.7 A on binding of cAMP to the anti-cAMP -binding sites of the protein The distance between the sulfur atom of Cys178 and the C9C10 bond of the indole ring of Trp85, derived from ... in the movement of the C-terminal domain of CRP by % A towards the N-terminal domain, which in consequence leads to rearrangement of DNA- binding domains and cAMPbinding domains of the protein...

Ngày tải lên: 20/02/2014, 23:20

... perturbation of the DNA- binding interface showed that, in the case of HPV-16, most of the binding energy comes from a ‘direct readout’ recognition mode [22] In fact, recognition of DNA by proteins, ... the presence of Lys349 in the loop connecting helix a2 and strand b4 This residue may have a role in DNA binding, as a single mutation of Lys349 to alanine weakens the DNA binding of the HPV-16 ... structure at 1.7 A of the bovine papillomavirus-1 E2 DNA- binding domain bound to its DNA target Nature 359, 505–512 11 Hegde RS & Androphy EJ (1998) Crystal structure of the E2 DNA- binding domain...

Ngày tải lên: 16/03/2014, 10:20

... (CD14+), Page of 11 (page number not for citation purposes) Arthritis Research & Therapy Vol 11 No Du et al Figure Evaluation of FCM analysis of GR binding by RLBA Analysis of GR binding in (a) ... physiological doses of glucocorticoids (prednisone mg/day orally) The expression and binding of GR as mean fluorescence intensity (MFI) of lymphocytes (CD3/GR) and monocytes (CD14/GR) containing receptors ... cultured at 37°C in the presence of 5% carbon dioxide PHA at the dose of 10 μg/mL was used to stimulate the cells in the presence or absence of 10-6 M of Dex After 48 hours of culture, supernatants were...

Ngày tải lên: 09/08/2014, 14:22

... phosphorylation state of their proteins, thereby changing the amount and localization of Bcl-2 family members However, each type of cancer has its own way of disrupting the balance of the networks of signaling ... associated with stimulation of ERK1 ⁄ and Pak1 pathways, gefitinib might lead to inhibition of invasiveness of human cancer cells through the inhibition of ERK1 ⁄ and Pak1 The use of gefitinib in cells ... of Bax activation in response to a variety of apoptosis-inducing stimuli Molecular mechanisms of sensitivity to EGFR-TKIs JNK and mitogen-activated protein kinase phosphatase-1 The activity of...

Ngày tải lên: 16/02/2014, 09:20

... structure of the DNA binding domain of the heat shock transcription factor Science 263, 224–227 Vuister GW, Kim SJ, Orosz A, Marquardt J, Wu C & Bax A (1994) Solution structure of the DNA- binding ... nature of the repeats, positions all of the GAA units on the same side of the double helix, with the central GAA oriented in the opposite direction In vitro, Drosophila HSF is capable of binding ... sequences of the different types of HSEs The GAA and inverted TTC sequences are indicated by bold uppercase letters with arrows (B) HSF binding to the different types of HSEs Thick lines represent DNA...

Ngày tải lên: 18/02/2014, 04:20

... 29 31 Binding of APUM to NRE To test the predictions regarding the RNA -binding specificities of the putative APUM proteins, we investigated the capacity of APUM to bind to the NRE sequence of hunchback ... APUM-2 (A) Scheme of the three-hybrid strategy used in the screen (B) Number of colonies identified in each step of the screen (C) Distribution of the 63 distinct sequences in relation of their position ... is significantly lower (Table 5) As a result of the high occurrence of the APUM binding sites in the plant genome, we decided to focus in the binding of APUM consensus to 3¢ UTR transcripts expressed...

Ngày tải lên: 18/02/2014, 06:20

... the use of as little as nmol of protein with a molecular mass > 10 kDa [16,18,21] STD-NMR spectroscopy was used to analyze the binding of cellohexaose to CtCBM11 The STD-NMR spectrum of the hexasaccharide ... complexes, it is clear that there is a common binding site at the CtCBM11 A B C Fig Representation of the conformations of the 3D structure of binding of the different ligands obtained by docking ... technique The ability of the STD-NMR technique to detect the binding of low molecular weight compounds to large biomolecules has been demonstrated previously [16,18–20] This technique offers several...

Ngày tải lên: 18/02/2014, 17:20

... that there was no amplification of traces of the genomic DNA (data not shown) Expression of the cloned receptor in Xenopus oocytes The ORF region of the novel receptor cDNA was amplified and inserted ... sequence of the oct-TKRPR is 26.8–43.6% homologous to the sequences of TKR and Octopus tachykinin-related peptide receptor the TKRPR family (Table 2) Molecular phylogenetic analysis of TKR and ... to the clade of protostome TKRPRs (Fig 2) These results indicated that the cloned receptor is a novel homolog of the TKRPR Functional analysis of oct-TKRPR in Xenopus oocytes TKRP cDNAs are known...

Ngày tải lên: 19/02/2014, 00:20

... PGM4 targets) Effects of DNA cis-platination on sequencespecific DNA binding of p73 proteins We tested the influence of DNA modification with cisplatin on the binding of two p73 isoforms, p73d and p73b, ... severe deformations of the binding site with concomitant destabilization of the p53 DNA interaction (or even prevention of target recognition by the protein) DNA binding of the C-terminally truncated ... cis-platinated DNA, which have been shown to be mediated primarily by the p53 C-terminal DNA- binding site (CTDBS) [34] In the presence of competitor nonspecific DNA, sequence-specific binding of the p53(1–...

Ngày tải lên: 19/02/2014, 05:20

... variants of the human POLDIP3 gene encoding proteins of 421 amino acids with a molecular mass of 46 kDa and 392 amino acids with a molecular mass of 43 kDa, which differ only by an insertion of 29 ... there was a band of a protein with electrophoretic mobility of approximately 46 kDa, which corresponds to the molecular mass of isoform ⁄ a of PDIP46 ⁄ SKAR (Fig 3C) The band of this protein was ... plasmids using Lipofectamine Reagent according to the manufacturer’s suggested protocol (Invitrogen) Briefly, a mixture of lg of the plasmid DNA and lL of Lipofectamine in mL of antibiotic- and...

Ngày tải lên: 19/02/2014, 05:20

... spectrum of each sample Spectra of the bound receptor N-domain were obtained by measuring the spectra of the equimolar mixture of the receptor N-domain and IL-8(1– 66), and subtracting the spectra of ... function of temperature [26] To dissect coupling between structure induction and binding, we also measured binding in the presence of TMAO As chemokine receptor N-domains are acidic in nature, binding ... the enthalpy (DH), entropy (DS), and the free energy (DG) of binding of monomeric IL-8 to the receptor CXCR1 N-domain The binding isotherm of IL-8(1–66) and the trapped L25NMe monomers to the CXCR1...

Ngày tải lên: 19/02/2014, 05:20

... The DNA binding activities of the Rad51 mutants (A) The ssDNA binding experiments The /X174 circular ssDNA (40 lM) was incubated with HsRad51 or the Rad51 mutants at 37 °C for 10 (B) The dsDNA binding ... changes of these proteins were almost saturated at bases per monomer of poly(dT), showing that the changes were mainly due to the binding of the first DNA, while the binding of the second DNA had ... Therefore, the DNA- binding mode of HsRad51 should be somewhat different from that of HsDmc1 The octameric ring form [38,39] and the helical filament form [40] of HsDmc1 are capable of binding DNA, but...

Ngày tải lên: 19/02/2014, 06:20

... treatment of WDEIA Results Identification of IgE -binding epitopes in x-5 gliadin The IgE -binding epitopes of x-5 gliadin were analysed in three patients with WDEIA The detected amino acid sequences of ... peptide of 19 amino acids The molecular mass of the protein without the signal sequence was calculated to be 50 900 Expression in E coli and purification of recombinant x-5 gliadin As DNA encoding ... shares the IgE -binding epitopes in nOG5 by dot blot inhibition experiments with sera of the three patients The binding of IgE to nOG5 was completely inhibited by increasing amounts of rOG5C in all...

Ngày tải lên: 20/02/2014, 01:20

... 2010 FEBS T Masuda et al DNA- binding sites of Mhr1 Table DNA- binding activity of the Mhr1 variants N, DNA- binding activity is comparable to that of the wild type; +, DNA- binding activity is slightly ... a DNA- bindingdeficient mutant via a single-site mutation Next, we focused on the Mg2+-dependent DNAbinding activity of Mhr1, as Mg2+ increased the DNAbinding activity of Mhr1 The enhanced DNA- binding ... defects in DNA binding (Fig 5A), although their DNA- binding activities were not completely lost We also examined the DNA- binding activity of Mhr1 in the absence of Mg2+, because the DNAbinding activities...

Ngày tải lên: 06/03/2014, 09:22

... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was ... could participate in the binding of the dimeric /11 CI to the major groove of operator DNA helix (Fig 3A) The average size of each DNase I-protected region of operator DNA was found to be approximately ... utilized for overexpression of /11 CI in E coli Molecular biological techniques Plasmid DNA isolation, DNA estimation, digestion of DNA by restriction enzymes, modification of DNA fragments by modifying...

Ngày tải lên: 07/03/2014, 00:20