modification of splicing pathways as a research tool

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

... is to have most of the main data-set replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each of the collaborating sites ... reconstruct a missing packet The virtual representation of a remote collaborator (avatar) is often captured as the position and orientation of the 3D tracking devices that are attached to the ... data to a multicast address and the routers that receive the data send copies of the data to remote sites that are subscribed to the multicast address One drawback of multicast is that it is often...

Ngày tải lên: 19/06/2014, 10:20

10 449 0
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

... are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves ... process of preparation, and has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a...

Ngày tải lên: 20/02/2014, 11:20

15 588 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

... the GAD-7 scale and the Hamilton Anxiety Scale (HAM -A) , the Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability questionnaire was calculated Concordance ... Servet, Zaragoza, Spain 2ISCIII- REDIAPP, Red de Investigación en Actividades Preventivas y Promoción de la Salud, Zaragoza, Spain 3Sant Antoni de Vilamajor Primary Care Health Center, ABS Alt Mogent, ... physicians in urban areas in the provinces of Madrid, Zaragoza, and Barcelona) among those attending their practices Inclusion criteria were as follows: patients of both sexes over 18 years of age;...

Ngày tải lên: 18/06/2014, 19:20

11 537 0
Tài liệu mẫu phân tích IPA  Importance   performance analysis as a strategic tool for destination attractiveness an analysis of domestic

Tài liệu mẫu phân tích IPA Importance performance analysis as a strategic tool for destination attractiveness an analysis of domestic

... s c o m [39] Bindu Narayanan, Chandrasekharan Rajendran, Prakash Saia, L, Ram Gopalan,“Dimensions of service quality in tourism – an Indian perspective”, Total Quality Management, Vol 20, No ... heritage and art forms, local festivals, road drives and activities for children As (1) asserted that it is important to measure consumer satisfaction applying as many destination attributes as ... like the Vaastu Vidya Gurukulam, which gives training in vaastu shastra and a school for Mohiniattam dancer Further, the tourists can learn handicrafts, local cuisines, rural games and mingle...

Ngày tải lên: 01/08/2014, 10:25

7 876 3
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc

... rebmun A la te sisylana DPAR aidnI ,ragantazI ,etutitsnI hcraeseR yranireteV naidnI ,yrotarobaL airetcabocyM eht ta muidem nesneJ-nietsnewoL no deniatniam dna ]62[ stset lacimehcoib dna )gniniats ... sisylana )DPAR( AND cihpromylop deifilpma modnar yb sniarts )CEPA( iloc E cinegohtap naiva fo noitaitnereffiD B S nosnevS ,J najayeerpisaS ,P atoosamaR ,N iahcnropirisnahC 49-58 ,3 ,1991 lppA sdohteM ... gniraeppa dnab AND a fo )0( ecnesba ro )1( ecneserp fo sisab eht no tliub saw dna slaremun eht fo desopmoc xirtam atad A hpargotohp a no deton erew DPAR yb deniatbo snrettap gnidnab ehT )ynamreG...

Ngày tải lên: 07/08/2014, 18:21

7 323 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... Croal was supported by a grant from Grampian Endowments Jeremy Grimshaw holds a Canada Research Chair in Health Knowledge Transfer and Uptake The views expressed are those of the authors and...

Ngày tải lên: 10/08/2014, 10:23

9 368 0
Báo cáo y học: "Measurement of PEEP-induced alveolar recruitment: just a research tool" ppt

Báo cáo y học: "Measurement of PEEP-induced alveolar recruitment: just a research tool" ppt

... measuring FRC with the inert gas wash in-wash out technique is now commercially available, which may permit noninvasive estimation of the end-expiratory lung volume Should the measurement of ... that a physiological PEEP setting strategy, based on P-V curve measurements, may reduce mortality in ARDS patients In this regard, the implementation of bedside measurement of P-V curves and alveolar ... AS: Effect of mechanical ventilation on inflammatory mediators in patients with acute respiratory distress syndrome: a randomized controlled trial JAMA 1999, 282:5461 Amato MB, Barbas CS, Medeiros...

Ngày tải lên: 13/08/2014, 01:20

2 109 0
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt

... scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by the psychiatrist was used as standard reference The Receiver Operator ... However, the scale has moderate discriminatory capabilities as a diagnostic tool for depression and anxiety Compared to a psychiatric assessment, the AYMH scale has low sensitivity and is a weak instrument ... gender and psychiatric diagnoses of anxiety and depression) and one way analysis of variance (ANOVA) for associations with happiness, self-rated health, self-rated mental health, worrying about...

Ngày tải lên: 13/08/2014, 18:21

7 386 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...

Ngày tải lên: 23/04/2013, 21:38

7 391 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... 2009 Fig Location of the artificial and natural tidal flats in Tategami, Ago bay, Mie, Japan Table Sediment of artificial tidal flats in real seashore Run E1 E2 E3 E4 E5 Granulation of DS 1.5wt%...

Ngày tải lên: 05/09/2013, 09:38

13 586 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... feasible as great amounts of this valuable commodity would be wasted Besides lignin, miscellaneous components of wheat straw such as wax, pectin, and phenolic acids are also of great value and...

Ngày tải lên: 05/09/2013, 15:28

20 437 0
Tài liệu Speaking as a Marketing Tool ppt

Tài liệu Speaking as a Marketing Tool ppt

... Sullivan speaking as a marketing tool can really create some wonderful and qualified leads because they have already bought in Robert: I absolutely agree Now, I have a message I am excited about ... area and said, “Some weeks I was speaking for breakfast, lunch, and dinner five days or six days a week giving my talk.” He was so committed, so evangelical about that message that everybody wanted ... you, that’s a clue That’s a clue that they are not taking this seriously, that they are not going to help you and you can always back out You can always say, “I am so thrilled that you are pleased...

Ngày tải lên: 16/01/2014, 22:20

40 327 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Hypothesis Partnership Rate Although the association between Internet access at home and having a romantic partner is a strong and statistically significant association, several important caveats apply...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

... phosphate as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... measured by the Bradford method [51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and...

Ngày tải lên: 16/03/2014, 05:20

14 442 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... mitochondria have a replicative advantage over normal mitochondria [56,57] Analogous selection for dysfunctional mitochondria may also occur in the case of aging; Wanagat et al recently reported that atrophic ... initiating the age-related accumulation of garbage Given this, it is reasonable to expect a further decrease in autophagocytotic capacity at old age and this may be related to the progressive accumulation...

Ngày tải lên: 17/03/2014, 23:20

7 444 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater likeliness ... ameliorating balance and gait problems among elderly individuals Jacobson et al (2005) reported pilot results of Argentine tango lessons compared to walking on clinical measures of balance and gait...

Ngày tải lên: 28/03/2014, 20:20

19 649 0
Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx

Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx

... students, and community associations The program worked by offering discounted bus passes to individuals who purchased passes as part of a larger group-purchasing program The discount pass acted as an ... accurate account of all areas of learning Kadzin says, “more research has shown that conditioning itself is more complex than Community-Based Social Marketing as a Planning Tool September/2002 Page ... Community-Based Social Marketing as a Planning Tool local, state, and federal government agencies” (Global Action Plan) The U.S program is part of a larger international effort that is operating in...

Ngày tải lên: 29/03/2014, 23:20

70 425 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

... metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y., Hayashi, T., Tanaka, A. , Watanabe, Y., Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an extracellular ... essential trace nutrient for growth of WI-38 diploid human fibroblasts Proc Natl Acad Sci U.S .A 73, 2023–2027 Takahashi, K., Akasaka, M., Yamamoto, Y., Kobayashi, C., Mizoguchi, J & Koyama, J (1990) ... hydroperoxide was added [15] The oxidation of NADPH was followed at 340 nm at 37 °C and activity was expressed as micromoles of NADPH oxidized per minute TR enzyme assay TR activity was examined by...

Ngày tải lên: 31/03/2014, 08:20

6 371 0
w