... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... base pairs presented in the plus-sense RNA occur as nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3';...
Ngày tải lên: 18/06/2014, 22:20
... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... base pairs presented in the plus-sense RNA occur as nonpairing C /A bases in the minus-sense RNA Interestingly, in Puumala hantavirus, a hairpin-like structure formed by a highly conserved inverted ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3';...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Proximal femoral fracture in a man resulting from modern clipless pedals: a case report" ppt
... femoral head in the adult is through the intra-osseous and capsular vessels, emanating mainly from the medial circumflex femoral artery, a branch of the profunda femoris artery When a displaced intra-capsular ... bicycle pedals As such users risk only finding out that they have over tightened the binding mechanism when they cannot release their foot in an emergency resulting in a fall and a potential injury ... required information for the preparation of the manuscript Both authors have read and approved the final manuscript Competing interests The authors declare that they have no competing interests...
Ngày tải lên: 10/08/2014, 23:21
crowder - post modern investment; facts and fallacies of growing wealth in a multi-asset world (2013)
... market in ideas, such that any ‘‘new’’ approach to investment management or asset allocation offering new advances often reflects marketing advances more than an asset-management advance After all ... Attributes and Strategy Allocation The Myth of Average: Asset Allocation in Extreme Markets Alternative Asset Allocation Approaches A Personal View: Issues in Asset Allocation What Every Investor ... traditional asset classes as well THE CORE CONCEPTS IN MANAGING WEALTH At its core, risk management and asset allocation require asset managers and their investors to jointly appreciate the fundamental...
Ngày tải lên: 01/11/2014, 13:14
Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx
... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... candidate insecticidal compounds showing both inductive and potentiative activity Results The DNA-binding domains (DBDs) of Leptinotarsa and Drosophila EcR and USP are identical at every amino acid ... Ogura T, Minakuchi C, Nakagawa Y, Smagghe G & Miyagawa H (2005) Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato...
Ngày tải lên: 18/02/2014, 08:20
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx
... of Science, Jazan University, Jazan, Kingdom of Saudi Arabia *Corresponding Author: kismail@jazanu.edu.sa, sayeedkhatib@hotmail.com Abstract Smear microscopy and culture forms the backbone of tuberculosis ... strategies are not being achieved Passive case finding is the mainstay of case finding in most developing countries This relies heavily on sputum examination by smear and culture, chest radiology ... (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints The present study aimed to re-evaluate the efficiency of smear microscopy...
Ngày tải lên: 15/03/2014, 03:20
bottle creek a pensacola culture site in south alabama mar 2003
... remembering that southeastern archaeology began in south xxii / Foreword Alabama and it was directed to the late Renaissance antiquarian desire to join New World archaeological and ethnographic ... site and perhaps not What is certain is that this quasi-archaeological expedition was designed to augment the Parisian Cabinet of the learned King of France with statues taken from a pagan shrine ... of American National Standard for Information Science–Permanence of Paper for Printed Library Materials, ANSI Z39.48-1984 Library of Congress Cataloging -in- Publication Data Bottle Creek : a Pensacola...
Ngày tải lên: 11/06/2014, 13:26
báo cáo hóa học: " A refined in vitro model to study inflammatory responses in organotypic membrane culture of postnatal rat hippocampal slices" potx
... Sanz O, Acarin L, Gonzalez B, Castellano B: NF-kappaB and IkappaBalpha expression following traumatic brain injury to the immature rat brain J Neurosci Res 2002, 67:772-780 Hawiger J: Innate immunity ... Matsuda S, Sudo S, Fujita H, Sakanaka M, Maeda N: Induction of resting microglia in culture medium devoid of glycine and serine Glia 1998, 24:198-215 Nakamura Y, Si QS, Kataoka K: Lipopolysaccharide-induced ... Ewen MacDonald for checking the language of the manuscript and Mr Pasi Miettinen and Mrs Airi Boman for technical assistance This study was financially supported by the Academy of Finland and University...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... and maximally stretched state at each power setting in 16-bit gray-scale at 16× magnification using a Polaroid DMC2 digital microscope camera (Polaroid, Wayland, MA, USA) connected to a Leica ... overall strain in this example) The local strains in the central region were found to be dramatically lower than the strain in either end region Strain values are reported as mean ± one standard ... cartilage Since type X collagen is a marker of hypertrophic cartilage and osteoarthritic cartilage, our data suggest that mechanical strain above certain threshold (2.5%) may contribute to activation...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo khoa học: "Effects of Protein Source and Energy Substrates on the In Vitro Development of Bovine Embryos in a Two-step Culture System" ppsx
... non-essential amino acids stimulated blastocyst formation According to Liu and Foote [14] nonessential amino acids (NEAA) have a stimulatory effect upon all developmental stages, and essential amino acids ... stain prepared with sodium citrate (2.3%) and ethyl alcohol was added The slide was then incubated on a warming plate for min, the extra stain was discarded, and Permount was added along with a ... at a local abattoir and transported to the laboratory in saline (25-30℃) containing antibiotics (100IU/㎖ penicillin, 100㎍/㎖ streptomycin) Follicular fluid, with oocytes, was aspirated from small...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: "Rejuvenation of a 100 yr old giant sequoia (Sequoiadendron giganteum Buchholz) through in vitro meristem culture" ppt
... organogenic potentialities, including rooting abilities, as the juvenile clone This rejuvenation has been maintained for more than yr for in vitro as well as for outdoor cultivated rooted cuttings ... 1135 In: Bases de la multiplication vegetative INRA, Versailles, France pp 262 Monteuuis O (1985) La multiplication v6g6ta- Margara J (1982) tive du sequoia g6ant en vue du clonage Ann AFOCEL 1984139-171 ... be powerful analytical tools for giant sequoia, are actually being applied at AFOCEL to other promising forest species in order to enhance their ability for true-to-type cloning foliar 1976) Our...
Ngày tải lên: 09/08/2014, 02:21
Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps
... (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 (5'ATGGAGCTGCAAGGGGTGAG, 3'-CCCGTCACCTCCAATCCAAG), and ... treated with DNase I (Takara, Ohtsu, Japan), and RT-PCR was carried out using OneStep RT-PCR Kit (Qiagen) and the following primers: β-actin (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), ... clinical trials [26] We previously showed that chemokines CCL2 and CCL5 play a role not only in inflammatory cell migration but also in activation of RA FLS in an autocrine or paracrine manner...
Ngày tải lên: 09/08/2014, 07:20
Fibroblast-like synovial cells from normal and inflamed knee joints differently affect the expression of pain-related receptors in sensory neurones: a co-culture study ppsx
... Oh-Hashi K, Naruse Y, Iijima N, Ueda M, Shimosato G, Tominaga Y, Tanaka Y, Tanaka M: Local inflammation increases vanilloid receptor expression within distinct subgroups of DRG neurons Brain Res ... and an image analysing system (KS 300, Zeiss, Germany) The mean area and mean grey value were determined for each neuronal soma To take into account differences in the basal grey values Page ... neurones and FLS cells isolated after induction of acute antigen-induced arthritis (AIA) Dark DRG neurones (arrows) show bradykinin-gold labelling (b) Same cells as in (a) double-labelled with an anti-neurone-specific...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: a basic science study" pot
... examined in this system, and the involvement of a mechano-transduction pathway via the integrin/mitogen-activated protein kinase (MAPK) pathway and of another signaling pathway via β-catenin was evaluated ... LIPUS may activate β-catenin signaling via the PI3K/Akt pathway As indicated in Figure 4c,d, the nuclear localization of β-catenin, as a marker of the β-catenin signaling, was more prominent in LIPUS-stimulated ... collagen (c) Focal adhesion kinase (FAK) and phosphorylated FAK (p-FAK) (d) Paxillin blotting analysis and phosphorylated Paxillin (p-Paxillin) (e) Mitogen-activated protein kinase (MAPK) and...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Culture-negative bivalvular endocarditis with myocardial destruction in a patient with systemic lupus erythematosus: a case report." ppsx
... unavailable PCR primers for a specific organism or by processing errors resulting in sample degradation There are a few limitations of our patient’s initial workup that may have masked a causative ... of the patient and wrote the initial manuscript BS participated in the care of the patient and edited the manuscript All authors participated in approving the final manuscript Competing interests ... whipplei [10] Among 115 patients without a documented infection, 2.5% had non-infective endocarditis including marantic endocarditis, collagen vascular diseases, angiosarcoma, and atrial myxoma [10]...
Ngày tải lên: 10/08/2014, 09:22
báo cáo khoa học: " Salivary a-amylase exhibits antiproliferative effects in primary cell cultures of rat mammary epithelial cells and human breast cancer cells" docx
... cell carcinoma of the breast J Clin Pathol 2005, 55:545-547 Tanahashi C, Yasuki S, Akamine N, Yatabe Y, Ichihara S: Pure acinic cell carcinoma of the breast in an 80-year-old Japanese woman Pathol ... at cranial cervical location; MaCa: mammary carcinoma; P1: cell passage 1; PBS: phosphate-buffered saline; SA-β-gal: senescence-associated-β-galactosidase; SEM: standard error of the mean Acknowledgements ... blind- and non-blind-performed investigations a- Amylase treatment in human mammary epithelial cells The effect of a- amylase in mammary cells of human origin was studied in primary HBCEC (mammary...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: " Curcumin mediated suppression of nuclear factor-κB promotes chondrogenic differentiation of mesenchymal stem cells in a high-density co-culture microenvironment" pdf
... curcumin as a potential new therapeutic for the prophylactic treatment of OA/RA and for OA/RA cases where cartilage damage is marginal Abbreviations AP30 3a: alkaline phosphatase linked sheep anti-mouse; ... matrix degrading enzymes (3) such as MMPs and aggrecanases These events promote cartilage degradation and stimulate further joint inflammation (4) and a self-perpetuating inflammatory and catabolic ... Bharti AC, Donato N, Singh S, Aggarwal BB: Curcumin (diferuloylmethane) down-regulates the constitutive activation of nuclear factor-kappa B and IkappaBalpha kinase in human multiple myeloma...
Ngày tải lên: 12/08/2014, 14:22
Lived experience in a neighbourhood wet market culture and social memories of a disappearing space 3
... occupation(s) Number of years that informant has been hawking in this market Number of years that informant has been hawking in other markets (if applicable) Part Two: Building a hawking biography; ... concerned about increasing our awareness of our fading heritage and vanishing landmarks in the face of rapid economic development, what you think about the idea that the wet market may be disappearing? ... market as part of Singapore‟s „heartland heritage‟ and as a social space for the community I understand that you are a blogger who is deeply interested in capturing memorable places and landmarks...
Ngày tải lên: 01/10/2015, 17:26
Lived experience in a neighbourhood wet market culture and social memories of a disappearing space 1
... Board saga captivated my imagination, and eventually culminated in the birth of this thesis I also continued to learn much about anthropology and teaching from A/ P Waterson during my postgraduate ... When I was an undergraduate, A/ P Roxana Waterson also fuelled my anthropological imagination and curiosity for diverse forms of social life and peoples She was an outstanding academic and teacher ... Goh, and Emilyn Yeo My Sociology and intellectual playmates: Leong Si Ngah, Lionel Loh, Crystal Abidin, Teresa Tan, Cindy Liu, Woo Wee Meng, Mohammad Khamsya, Shamil Zainuddin, and Pamela Chia The...
Ngày tải lên: 01/10/2015, 17:26
Lived experience in a neighbourhood wet market culture and social memories of a disappearing space 2
... interaction 21 „Hua‟ is flower in Mandarin, and „Ah Hua‟ can be a name for a young woman, who is likened to a blossoming flower „Ah Ma‟ is Grandma in Mandarin 22 SIA stands for Singapore Airlines ... that social organizations and meanings are not merely salient in Bedok Market, but are also created and realized in this space In Chapter 5, I adopt a narrative stance to the tales that four categories ... appropriate for that relation, bar other transactions as inappropriate, and adopt certain media for reckoning and facilitating economic transactions within that relation‟ (ibid.:35) During relational...
Ngày tải lên: 01/10/2015, 17:27