modeling a human head
Development of a subcortical emphasized physical human head model for evaluation of deep brain source contribution to scalp EEG
Ngày tải lên :
09/09/2015, 10:02
... electrical characteristics of the artificial brain, skull and scalp materials (2) Evaluate the reliability of using a human head phantom system for EEG studies (3) Evaluate the capability of scalp ... subcortical level and deep brain region Brain activity measurement and brain source localization necessitates the development of a realistic physical human head model In this research, the physical head ... D1 at somatosensory cortex, D2 at parietal cortex, D3 at motor cortex, D4 at corpus callosum, D5 at thalamus, D6 at hypothalamus, D7 and D8 at brain stem 87 xii LIST OF ABBREVIATIONS AND ACRONYMS...
- 115
- 287
- 0
Development of a realistic finite element model of human head and its applications to head injuries
Ngày tải lên :
10/09/2015, 09:04
... membranes they are dura ma s, e ater, a barachnoida space as well as the pia mater The dura mater al m arachnoidea mater, sub is a tough fibrous a h, and dense membrane, while the arachnoid mater ... facial bones and cranial bones as well as intracranial injuries are evaluated based on the tolerance limits of the biomechanical parameters General trend of maximum intracranial biomechanical parameters ... enoid bones as well as paired pari s s ietal and tempor bones, w ral while the fa acial bones are made up of the u unpaired vo omer and mandi ible as well as paire lacrimal, nasal, pa ed alatine,...
- 347
- 367
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
Ngày tải lên :
19/02/2014, 06:20
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...
- 10
- 647
- 0
Báo cáo khoa học: Characterization of inhibitors of phosphodiesterase 1C on a human cellular system potx
Ngày tải lên :
07/03/2014, 05:20
... and antisense primer sequences were 5¢-TGTGAGT CCATTAATCGATGAAACC-3¢ and 5¢-ACCTGATCG CTTGGCATCTG-3¢, respectively The probe sequence was as follows: (FAM)-AGCTGATGCTATTCAAACTCGA ACGCCTCT-(TAMRA) ... The day after seeding, cells were transfected with 10 nm pan-PDE1C siRNA smart pool (Ambion Inc., Austin, TX, USA) [pool number M-007643– 00, sequences CCAAGGAGATTGAAGAATT (1), GAT CATGCACTGAAATTTA ... monocyte-to-macrophage differentiation Proc Natl Acad Sci USA 102, 497–502 Kaneda T, Watanabe A, Shimizu K, Urakawa N & Nakajyo S (2005) Effects of various selective phosphodiesterase inhibitors on carbachol-induced...
- 13
- 462
- 0
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
Ngày tải lên :
07/03/2014, 15:20
... Dual Color standardsÕ (Bio-Rad) (10–250 kDa) were used for estimation of molecular mass Polyclonal antisera against cytochrome c oxidase subunits VI and VIa were kindly supplied by J W Taanman ... cytochrome bc1 and its implication for energy conversion Proc Natl Acad Sci USA 97, 4567–4572 Saribas, A. S., Valkova-Valchanova, M., Tokito, M.K., Zhang, Z., Berry, E .A & Daldal, F (1998) Interactions ... mitochondrial membrane preparations (data not shown) This could be a result of the instability of the mutant enzyme and an increased sensitivity to degradation during membrane preparation, as discussed...
- 7
- 498
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian protein ... 136, 630–637 16 Nakamura, H., Matsuda, M., Furuke, K., Kitaoka, Y., Iwata, S., Toda, K., Inamoto, T., Yamaoka, Y., Ozawa, K & Yodoi, J (1994) Adult T cell leukemia-derived factor /human thioredoxin ... (ClonTech) was used as a template for PCR to create in-frame constructs for further cloning Human thioredoxin fulllength cDNA was also isolated by PCR-amplification using human fetal brain library (ClonTech)...
- 9
- 533
- 0
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
Ngày tải lên :
16/03/2014, 06:20
... I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signaling tail Like MHC class I HC, the FcRn counterpart ... Sundaresan G, Subbarayan M, Carter NH, Ikle DN, Yazaki PJ, Chatziioannou AF, Gambhir SS et al (2005) Tailoring the pharmacokinetics and positron emission tomography imaging properties of anti-carcinoembryonic ... The Authors Journal compilation ª 2008 FEBS 4103 A B A4 05 J T Andersen et al A4 05 FcRn HC mutant D A 405 C Fig Immunization, purification and evaluation of anti-FcRn antibody preparations Goat...
- 14
- 533
- 0
Báo cáo khoa học: "Discriminative Pronunciation Modeling: A Large-Margin, Feature-Rich Approach" docx
Ngày tải lên :
16/03/2014, 19:20
... Switchboard corpus In Proc International Conference on Spoken Language Processing (ICSLP) A Gunawardana, M Mahajan, A Acero, and J Platt 2005 Hidden conditional random fields for phone classification ... distance IEEE Transactions on Pattern Analysis and Machine Intelligence, 20(2) G Salton, A Wong, and C S Yang 1975 A vector space model for automatic indexing Commun ACM, 18 M Saraclar and S ... integrating local discriminative classifiers IEEE Transactions on Acoustics, Speech, and Language Processing, 16(3) R Prabhavalkar, E Fosler-Lussier, and K Livescu 2011 A factored conditional random...
- 10
- 297
- 0
Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
Ngày tải lên :
17/03/2014, 01:20
... gestures, and facial displays The robot (Figure 1) consists of a pair of manipulator arms with grippers, mounted in a position to resemble human arms, and an animatronic talking head (van Breemen, ... counter-examples to the claim that BLEU agrees with human judgements Also, Foster (2008) examined a range of automated metrics for evaluation generated multimodal output and found that few agreed ... interactions with the system—with a mean overall satisfaction score of 3.75—and rated their perceived task success particularly highly, with a mean score of 4.1 To analyse the emotional data, we averaged...
- 9
- 310
- 0
Báo cáo khoa học: "A Minimalist Head-Corner Parser" ppt
Ngày tải lên :
17/03/2014, 09:20
... justification for the fact that the latter are not head- corners T h e main idea of headdriven parsing is, as was stated before, that heads contain relevant information for the parsing process, and ... the functional domain Head- corner parsing T h e main idea behind head- driven parsing (Kay, 1989) is that the lexical entries functioning as heads contain valuable information for the parsing process ... bidirectionally T h a t is, first a potential head of a phrase is located and next the sisters of the head are parsed T h e head can be in any position in the string and its sisters can either...
- 3
- 140
- 0
Báo cáo khoa học: "A Semantic-Head-Driven Generation Algorithm for Unification-Based Formalisms" potx
Ngày tải lên :
17/03/2014, 20:20
... completeness and coherence become important For example, suppose a grammar associated the following strings and logical forms eat(john, X) 'John ate' ea~: (j olin, banana) 'John ate a banana' eat(john, ... analysis tree can be restricted to chain rules only, as the pivot (along with all intermediate nodes) has the same semantics as the root and must therefore be the semantic head Again, after a ... chosen as semantic head In a ruleforrelativeclauseintroductionsuch as the following(in highly abbreviatedform) nbarlg > nbarlN, sbar/N we can (and must) choose the nominal as semantic head to...
- 11
- 273
- 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
Ngày tải lên :
23/03/2014, 13:20
... translocated in TCDD-treated L-MAT cells We performed an nPKC translocation assay by fractionating L-MAT cells into cytosol and particulate fractions and then examining the translocation of each ... (A) RT-PCR analysis of L-MAT cell mRNA for PKCh HepG2 cell mRNA was used as a negative control Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) detection was performed as a control Total RNA ... v) CHAPS, 10–6% (v ⁄ v) Nonidet P-40 (NP-40) containing 100 lm AcDEVD–AMC (Calbiochem, San Diego, CA, USA) was added to each well Substrate cleavage to release free AMC was monitored against...
- 13
- 426
- 0
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
Ngày tải lên :
28/03/2014, 22:20
... Biochim Biophys Acta 1780, 914–920 Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al (1998) Pharmacophore identification of a chemokine ... Kinetic data analysis was performed using biaevaluation 4.1 software employing a two-state reaction model in agreement with the presence of linked reactions Analysis of amino acid sequences Ala scanning ... frequency acted as an antagonist (IC50 = 23 lm) and displayed an affinity of 5.6 lm A discrepancy in the potency of clone in phage format (nanomolar range activity) and in peptide format (micromolar range...
- 12
- 299
- 0
Being Prepared for a Human INFLUENZA PANDEMIC: A BUSINESS CONTINUITY GUIDE FOR AUSTRALIAN BUSINESSES potx
Ngày tải lên :
29/03/2014, 19:20
... provides Australian businesses and other organisations with a range of tools and information to help them prepare for a human influenza pandemic in Australia CHAPTER WHAT IS PANDEMIC INFLUENZA? Human ... available on the Department of Heath and Ageing website www.health.gov.au/pandemic) The Australian Health Management Plan for Pandemic Influenza will guide Australia’s response in managing pandemic ... http://www.public.health.wa.gov.au/1/422/2/pandemic_influenza.pm Australian Capital Territory http://www.health.act.gov.au/c/health ?a= &did=11088328 South Australia http://www.pandemicinfluenza.sa.gov.au/ Tasmania http://www.pandemic.tas.gov.au/ 13 CHAPTER...
- 59
- 235
- 0
The leg-to-body ratio as a human aesthetic criterion pdf
Ngày tải lên :
30/03/2014, 16:20
... to as necessary The testing session lasted about 15 and participants were debriefed following the experiment Results A Â Â repeated measure analysis of variance (ANOVA) with 71 participants was ... this investigation are consistent with the idea that the LBR plays a role in judgements of male and female physical attractiveness Overall, both male and female participants showed a preference ... height: An empirical review In C P Herman, M P Zanna, & E T Higgins (Eds.), Physical appearance, stigma and social behaviour (pp 113–140) Hillsdale, NJ: Erlbaum Sear, R., Allal, N., & Mace, R...
- 7
- 408
- 0
Báo cáo khoa học: A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein potx
Ngày tải lên :
30/03/2014, 20:20
... ON-XbaG ⁄ Bpro1m, 5¢-GA CTCTAGAGGGTTCGGGAGGAGGATCCCG-3¢; ONXbaG ⁄ Bpro1c, 5¢-GACTCTAGACTGGCCCACTATTTA CCCTCC-3¢; ON-GPBP-5c, 5¢-CTCGATGCCAATTTCAA ATAGGGAA-3¢; ON-polj-2m, 5¢-GACAAGCCGCCCTG GAAAGCAGGCCC-3¢; ... keratinocyte maturation and autoimmune pathogenesis Experimental procedures Synthetic oligonucleotides ON-GPBP-6c, 5¢-CTCGCTCGCCCAGGGAAGGAAAA GGGAAAAGAAGGGA-3¢; ON-GPBP-18 m, 5¢-GGCAT GGTTAACGTGGTTCTC-3¢; ... 5¢-GCAGCACAGC TGCATCCCTACCCCGCCCTCTC-3¢; ON-SP1Del, 5¢-CG CCGGGAGGGGGACGTAGTGGGGGAGAAT-3¢; ONNFjBmut, 5¢-TCTAGAGGGTTCGGGAGAAGGCTCGG CGTGTCG-3¢; ON-TATADel, 5¢-CAGGGGAGGGGAG GGGTGGGCCAGTCTAGA-3¢;...
- 15
- 134
- 0
Báo cáo khoa học: "Turn-Taking Cues in a Human Tutoring Corpus" potx
Ngày tải lên :
30/03/2014, 21:20
... very compa- rable to what a spoken dialogue system would have to analyze during a user interaction For each participant, student speech was isolated and segmented into breath groups A breath group ... Computational Linguistics (ACL '10) Association for Computational Linguistics, Stroudsburg, PA, USA, 177-185 Nigel Ward, Anais Rivera, Karen Ward, and David G Novick 2005 Root causes of lost time and ... groups, as this data had already been calculated for another experiment done with the HH corpus (Liscombe et al., 2005) Figure Conversation Segmented into Breath Groups Each breath group was automatically...
- 5
- 375
- 0