minor dominant 7th minor 7th and major 7th barre chords based on a
Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply
Ngày tải lên :
05/09/2013, 09:38
... optimization and application practically, the practicability and superiority of optimal operation technology for mixed-pump stations which has operating-mode adaptability in condition of ratios ... flow and pressure of each pump station are obtained after the first optimization, and will be considered as the dispatching commands After that, during the second optimization, the pump parallel ... OPTIMAL OPERATION MODEL OF MIXED-PUMP STATIONS WITH OPERATION-MODE ADAPTABILITY The First Optimization Model with Operation-mode Adaptability The outlet flow and pressure of each pump station on...
- 8
- 461
- 0
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
Ngày tải lên :
30/03/2014, 20:20
... GAG TTT TTC GGT GGC GGA GGG CAT CAC ATT ATC ATA AAA AAG TTA TTG CTT CTC CTA CTG ATG AAT AAC CCT CCC CCA CCG CAA CAG CGT CGC CGA CGG AGA AGG TCT TCC TCA TCG AGT AGC ACT ACC ACA 2.74 1.59 1.88 0.90 ... genome has been studied by several groups [5,7] Carels and Bernardi analyzed the contigs of A thaliana and concluded that the GC level of genes and coding regions, as well as gene densities and expression ... GC variation along eukaryotic chromosomes Gene 333, 135–141 Supplementary material The following material is available online Table S1 The codon usage, codon preference and amino acid usage of...
- 9
- 523
- 0
Báo cáo toán học: " Integrated acoustic echo and background noise suppression technique based on soft decision" docx
Ngày tải lên :
20/06/2014, 20:20
... conventional integrated algorithm for comparison, we also evaluated the performance of the conventional acoustic echo and noise suppression algorithm by Gustafsson et al [3] ,a which is a serial ... other superior statistical models characterizing the input signals such as the Laplacian and gamma as in [17], even though the Gaussian model can lead to more tractable mathematics Acknowledgments ... same authors is an approach of combined suppression of residual echo, reverberation, and background noise in a fashion of the post-filter following the traditional AEC [8] But, the cancellation...
- 17
- 326
- 0
Báo cáo hóa học: " Preparation and characterization of superhydrophobic surfaces based on hexamethyldisilazane-modified nanoporous alumina" pptx
Ngày tải lên :
21/06/2014, 01:20
... different materials: solid alumina surface with surface fractional area fS and air pockets with surface fractional area f V = 1-f S The resulting apparent water contact angle θ C on the nanoporous alumina ... pixels) and air pockets (red pixels) it represents an interesting alternative for potential technological applications Additional material Additional file 1: Water contact angles on alumina surfaces ... the alumina surfaces and participated in the analysis of the FTIR spectra AJ participated in the FTIR measurements and the analysis of the spectra and carried out the analysis of the water contact...
- 8
- 462
- 0
báo cáo hóa học:" Integrated acoustic echo and background noise suppression technique based on soft decision" pptx
Ngày tải lên :
21/06/2014, 17:20
... conventional integrated algorithm for comparison, we also evaluated the performance of the conventional acoustic echo and noise suppression algorithm by Gustafsson et al [3] ,a which is a serial ... other superior statistical models characterizing the input signals such as the Laplacian and gamma as in [17], even though the Gaussian model can lead to more tractable mathematics Acknowledgments ... same authors is an approach of combined suppression of residual echo, reverberation, and background noise in a fashion of the post-filter following the traditional AEC [8] But, the cancellation...
- 17
- 286
- 0
Báo cáo hóa học: " Integrated acoustic echo and background noise suppression technique based on soft decision" doc
Ngày tải lên :
21/06/2014, 19:20
... conventional integrated algorithm for comparison, we also evaluated the performance of the conventional acoustic echo and noise suppression algorithm by Gustafsson et al [3] ,a which is a serial ... other superior statistical models characterizing the input signals such as the Laplacian and gamma as in [17], even though the Gaussian model can lead to more tractable mathematics Acknowledgments ... same authors is an approach of combined suppression of residual echo, reverberation, and background noise in a fashion of the post-filter following the traditional AEC [8] But, the cancellation...
- 17
- 229
- 0
Báo cáo hóa học: " Research Article Motion Segmentation and Retrieval for 3D Video Based on Modified Shape Distribution" pdf
Ngày tải lên :
22/06/2014, 23:20
... shape feature extraction from each 3D video frame and analysis of its temporal change are extra important tasks as compared to motion capture data segmentation and retrieval Therefore, we have introduced ... (Volume One), Athena Scientific, Belmont, Mass, USA, 1995 T Matsuyama, X Wu, T Takai, and S Nobuhara, “Real-time 3D shape reconstruction, dynamic 3D mesh deformation, and high fidelity visualization ... (JSAI ’05), Kitakyushu, Japan, June 2005, 3F1-01 [13] Y Sakamoto, S Kuriyama, and T Kaneko, “Motion map: image -based retrieval and segmentation of motion data,” in Proceedings of ACM SIGGRAPH/Eurographics...
- 11
- 321
- 0
vertical transmission lines in multilayer substrates and highly integrated filtering components based on these transmiss
Ngày tải lên :
27/07/2014, 23:56
... signal via to control characteristic impedance and propagation constant in this functional part Simulation and measurement data for bandpass and bandstop filters presented demonstrate applicability ... Fukuoka, Japan, August 2005 Kushta, T & Harada, T (2008) A broadband transition from a via structure to a planar transmission line in a high-speed multilayer board, Proceedings of International Conference ... operation on one (fundamental) mode (for an example, TEM or Quasi-TEM), which has well-defined propagation constant and characteristic impedance, in a wide frequency band That is why, short and...
- 37
- 185
- 0
Báo cáo khoa học: "Comparative antibody response of five recombinant antigens in related to bacterial shedding levels and development of serological diagnosis based on 35 kDa antigen for Mycobacterium avium subsp. Paratuberculosis" pot
Ngày tải lên :
07/08/2014, 17:22
... were coated with µg of 35-kDa protein and alkaline phosphatase conjugated rabbit anti-bovine IgG (Sigma, USA) was used as the secondary reagent Absorbance was read twice at 405 nm using a BioTek ... of samples J Vet Diagn Invest 2002, 14, 423-426 Banasure KD, Basagoudanavar SH, Chaudhury P, Tiwari V, Parihar NS, Goswami PP Identification and characterization of a gene encoding a 35-kDa protein ... bacterial shedding using receiver operating characteristic (ROC) curve analysis (Analyse-it Software, www analyse-it.com) and, then ELISA based on 35 kDa antigen was compared with a commercial...
- 7
- 366
- 0
Báo cáo y học: "Infectious salmon anaemia virus (ISAV) isolated from the ISA disease outbreaks in Chile diverged from ISAV isolates from Norway around 1996 and was disseminated around 2005, based on surface glycoprotein gene sequences" pptx
Ngày tải lên :
12/08/2014, 04:21
... Norway, Faroe Islands, Scotland, USA, and Canada was performed Based on phylogenetic analysis of concatenated ISAV F and HE genes of 103 individual isolates, the isolates from the ISA outbreaks ... M, Jarpa M, Kibenge FSB: First detection, isolation and molecular characterization of infectious Salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) ... new=-2:17005] Nylund A, Plarre H, Karlsen M, Fridell F, Otten KF, Baratland A, Sæther PA: Transmission of infectious salmon anaemia virus in farmed populations of Atlantic salmon (Salmo salar) Arch Virol...
- 16
- 227
- 0
Báo cáo y học: "Pressure-dependent stress relaxation in acute respiratory distress syndrome and healthy lungs: an investigation based on a viscoelastic model" pps
Ngày tải lên :
13/08/2014, 20:21
... data analysis and writing DS participated in data measurement and assisted writing SS assisted data analysis and writing Additional files The following Additional files are available online: Additional ... Data analysis was based on a viscoelastic lumped parameter model Frequency related characteristics were investigated by impedance analysis Materials and methods Patients and mechanical ventilation ... frequencies caused less edema formation and histologic alterations than ventilation at high frequencies and identical tidal volume, airway plateau pressure, PEEP and peak pulmonary artery pressure Interpreting...
- 10
- 348
- 0
Soluble and stable near infrared dyes based on polycyclic aromatic compounds
Ngày tải lên :
10/09/2015, 08:36
... absorption in the 400-450 nm region called Soret band and weak absorption in the 500-700 nm region named Q band, both of which correspond to π–π* transitions The elongation of π-conjugation and ... 6.4.1 General 180 6.4.2 Detailed synthetic procedures and characterization data 181 6.4.3 Device fabrication and characterization 190 6.5 References 192 Chapter Conclusions and future research 196 ... applications For instance, for practical applications such as solar cells, the materials should have good light harvesting capability not only at UV-Vis spectral range, but also at the NIR range...
- 333
- 245
- 0
Efficient retrieval and categorization for 3d models based on bag of words approach
Ngày tải lên :
10/09/2015, 09:10
... done in this area As this thesis mainly focused on visual-similarity based methods, and especially using bag-of-words approach, the visual similarity based approaches and that based on bag-of-words ... retrieval approaches can be roughly categorized into four categories: statistical -based, spatial map -based, topology -based and view -based methods The statistical -based methods extract geometrical ... bag-of-words approach discards all the spatial information of local features, statistical diffusion distance is added to augment the contextual information The combination of geometrical and spatial information...
- 126
- 319
- 0
Fabrication and characterization of memory devices based on organic polymer materials
Ngày tải lên :
12/09/2015, 11:29
... 3.2.1 Preparation and Characterization of the PKEu Copolymer 63 3.2.2 Device Fabrication and Characterization 64 3.3 Results and Discussions 65 3.4 Conclusion 77 Reference 78 CHAPTER Material Properties ... all, ease of processing As an alternative to the more elaborated processes of vacuum evaporation and deposition of inorganic and organic molecular materials, manufacturers can eventually use an ... a random access memory that stores each bit of data in a separate capacitor As the real-world capacitors are not ideal and have tendency to leak electrons, the information eventually fades unless...
- 132
- 434
- 0
analysis of segregation in cross between wild soybean (glycine soja) and cultivated soybean (glycine max) based on morphology, agronomic traits and ssr marker
Ngày tải lên :
06/10/2015, 13:05
... GCGGTAAGATCACGCCATTATTTAAGA GCGTGTGCAAAATGTTCATCATCT GGCACGAATCAACATCAAAACTTC CACTGCTTTTTCCCCTCTCT AAGATACCCCCAACATTATTTGTAA TGCCGCGAGATTAATATAATTTGT GTGCGGCAAGAAGTTGAAATAAAG TCCGCGAGATAAATTCGTAAAAT ... wild soybean and cultivated soybean was analyzed for the segregation of phenotype and genotype based on morphological characters, agronomic characters and SSR marker The cross was generated before ... wild soybean and cultivated soybean Materials and methods 2.1 Materials + Xanh Ha Bac cultivar (Glycine max, landrace) + Accession Soja 182 (Glycine soja, Korea origin) + F2 population of the...
- 28
- 247
- 0
Improved productivity and quality of beef cattle based on locally available feed resources in north vietnam
Ngày tải lên :
15/11/2015, 19:23
... mountainous and lowland areas in North Vietnam, respectively Three approaches used to collect data were participatory rural appraisal, structured questionnaire, and secondary data collection Collected ... production system Compared to a farm in the lowland area, a farm in the mountainous area owned a three-time larger farmland area and spent more time for daily cattle feeding activities In a mountainous ... Studies on untreated and urea-treated rice straw from three cultivation seasons: Evaluation of straw quality through in vitro gas production and in sacco degradation measurements Animal Feed...
- 147
- 383
- 0
DSpace at VNU: Synthesis and characterization of Segmented polyurethanes based on polyethylene and polytetramethylene glycols (part I: Synthesis and characterization)
Ngày tải lên :
11/12/2017, 11:48
... tia l re fle c to m e tric d e te ctio n (M odel W a te rs 401, M illip o r e , M A , U SA) D a ta a n a ly s is o ccu rre d on a Waters data module model M 30 Calibration was based on a peak ... -2000 We can see c le a rlv th e c h a c te ris tic a b s o rp tio n band o f the O H -g ro u p a t ‘3447.9 cm 1w hich was a lm o st d isa p p e a re d in p o lv u re th a n e fo rm a tio n and th ... ro x im a to ly 15% (w /w ) A fou r*necke d íla s k , equipped w ith a s tir r e r , a n itr o g r iì in le t and o u tle t and a th c rm o m e te r, w as cha rge d w ith the diisocyanaU * s o...
- 7
- 168
- 0
DSpace at VNU: Synthesis and characterization of segmented Polyurethanes based on Polyethylene and Polytetramethylene glycols part 2: thermo-mechanical and sweling properties.
Ngày tải lên :
11/12/2017, 12:21
... used as catalyst rjhe reaction mixture was then cooled down to the room tem p eratu re Afterward 1,4-butane (iol as a chain extender was added and the chain extension reaction was carried out at ... M730 Calibration was based on a peak position calibration curve established using polystyrene standards (Millipore, Millford, MA, USA) Diisocyanate (MDCI) (Aldrich Bornem, Belgium) was vacuum distilled ... was equipped with a data processing module that allows substraction of the background an d normalization for sample veight Uniaxial stress-strain experiments were carried out on a Hounsfield Test...
- 6
- 162
- 0
DSpace at VNU: Research and Fabrication of an Antenna Based on Meta-materials with Negative Refractive Index
Ngày tải lên :
14/12/2017, 20:49
... Resonance characteristic of the microtrip antenna c) Resonance characteristic of the optimized metamaterial antenna Figure Resonance characteristic of the microtrip antenna and meta-material antenna ... band-width and gain for the antenna modelled Therefore, the application of artificial materials in the fabrication of microwave antenna overcome the disadvantages of the old strip-technology and ... comparison with a modeled antenna with unit cells the best resonance peak occurred at 6.8 GHz with return loss -12.2 dB Conclusion The fabrication and modeling simulation of a meta-materials based...
- 5
- 135
- 0