mhc cardiomyocytes from the transgenic a mhc embryonic stem cell line

Báo cáo y học: " The innate immune repertoire in Cnidaria - ancestral complexity and stochastic gene loss" pptx

Báo cáo y học: " The innate immune repertoire in Cnidaria - ancestral complexity and stochastic gene loss" pptx

... Metazoa Relationships at the base of the Metazoa Cnidarians are amongst the simplest animals at the tissue grade of organization, and are often regarded as the closest outgroup to the Bilateria ... 'basal' animals (Figure 1), particularly the anthozoan cnidarians Acropora millepora and Nematostella vectensis [12,13] and the planarian Dugesia japonica [14] Paradoxically, the genomes of these ... palmata and 11,450 genomic reads for Porites lobata A set of 36,820 ESTs from the fresh water sponge E fluviatilis is maintained in the lab of K Agata For the corals A millepora, A palmata and...

Ngày tải lên: 14/08/2014, 20:22

13 319 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... residues from the galactomannan oligosaccharides is caused by traces of an enzyme in the b-1,4endogalactanase preparation that is not active against the PNP-substrate Galacto-oligosaccharides that ... standard chemicals were either obtained from Sigma or Merck Potato arabinogalactan and onion arabinogalactan were obtained as described previously (Fractions F44) [21] Soy arabinogalactan was...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... substrate of alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and purification of the recombinant ... spoIIG amyR rA consensus r70 consensus TTAGACA TTAGACA TTGTACA TTGTTAC TTGTATT TTGACAG TTGTTTT TTGACA TTGACA 17 17 17 20 17 21 16 16–18 16–18 TTTG TTTG GTTG TATG TATG CTTG TGTG TNTG – TACAAT TACAAT...

Ngày tải lên: 16/03/2014, 16:20

11 505 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot

... sulfate fraction; lane 4, recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers ... SDS/PAGE (Fig 2) The data for NaoA purification are summarized in Table The specific activity of the purified NaoA was about 21 times higher than that of crude extract, and the yield was 34% The relative ... site in the enzyme; metal ions may also act in other ways We conclude that NaoA is a nitroalkane dioxygenase-like enzyme rather than a nitroalkane oxidase Its characteristics are not identical with...

Ngày tải lên: 31/03/2014, 08:20

6 255 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals and can acts on the a- and b-sites of the mammalian sodium channel [44] Therefore, ... inserted into pSPORT I The primers A3 were as follows: 5¢-GCCGGATCCCCGATGACGATGACAAG GATGGATATATAAGA-3¢ as forward primer containing a BamHI restriction enzyme site (underlined) and corresponding ... were the following: forward primer A1 , 5¢-GCCGGATCCTGATTGCCTA GAAGATGA-3¢; reverse primer A2 , 5¢-GCCCTCGAG TCAACCGCATGTATTACTTTCAG-3¢ The forward and reverse primers were preceded by BamHI and...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx

... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4 ... from database, performed the sequences analysis and critically revised the manuscript 14 16 18 19 Acknowledgements We are grateful to Natalia Gudiño for the language corrections of the manuscript,...

Ngày tải lên: 20/06/2014, 01:20

4 329 0
Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx

Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx

... determination of polymorphisms in codons 54 and 57, a fragment of 315 base pairs (bp) was amplified using the following primers: 5'-ATAGCCTGCACCCAGATTGTAG-3' (forward primer) and 5'-AGAGACAGAACAGCCCAACAC-3' ... of allele A aData from [6].bData from [7] polyarthritis, 15 patients with RF-positive polyarthritis, 16 patients with oligoarthritis and 13 patients with enthesitisrelated arthritis The mean age ... 78:245-248 Graudal NA, Madsen HO, Tarp U, Svejgaard A, Jurik G, Graudal HK, Garred P: The association of variant mannose-binding lectin genotypes with radiographic outcome in rheumatoid arthritis Arthritis...

Ngày tải lên: 09/08/2014, 08:22

4 318 0
Báo cáo y học: " Genetic variations of nucleoprotein gene of influenza A viruses isolated from swine in Thailand" ppsx

Báo cáo y học: " Genetic variations of nucleoprotein gene of influenza A viruses isolated from swine in Thailand" ppsx

... pathogenic avian influenza were retrieved from the database and included in the analysis human, classical swine and Eurasian swine lineages (Fig 1) The avian NP lineage contains all avian influenza virus ... (PB1), avian lineage (PB2, PA), Eurasian swine lineage (NA, M) and classical swine lineage (HA, NP, NS) [14,15] This serves as an example that certain influenza A strains can harbor an NP gene that ... Eurasian swine lineage and classical swine lineage Based on topology of the phylogenetic tree, the Eurasian swine lineage is closely related to the avian lineage and had been previously designated...

Ngày tải lên: 12/08/2014, 04:20

9 310 0
Báo cáo khoa học: " Phylogenetic analysis of the non-structural (NS) gene of influenza A viruses isolated from mallards in Northern Europe in 2005" ppsx

Báo cáo khoa học: " Phylogenetic analysis of the non-structural (NS) gene of influenza A viruses isolated from mallards in Northern Europe in 2005" ppsx

... Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele B Allele B Allele A Allele A Allele A Allele A Allele A Allele A Allele A ... EU518759 Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele B Allele A Allele B Allele A Allele B Allele B Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele A Allele ... When co-analyzed with other viruses isolated from mallards the isolates grouped separately by Eurasian and American lineages in both alleles, without any geographical assortment of the mallard origin...

Ngày tải lên: 12/08/2014, 04:21

13 326 0
Báo cáo y học: "Nef gene evolution from a single transmitted strain in acute SIV infection" ppt

Báo cáo y học: "Nef gene evolution from a single transmitted strain in acute SIV infection" ppt

... according to the regulations of the University of Wisconsin Institutional Animal Care and Use Committee, and the NIH Viral RNA isolation and cDNA synthesis Viral RNA was isolated from each animal at defined ... strain Both the MC simulation and mathematical calculation showed that divergence, diversity, and variance increase linearly as a function of time and sequence identity decays exponentially as a ... [34], the absence of outgrowth in a particular mutant lineage We have presented an examination of the property of star phylogeny in Figure where all the samples from two macaques satisfy the expected...

Ngày tải lên: 12/08/2014, 23:21

13 201 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

... detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal Cycler, ... calibration cultures and the sample, allowing a valid, direct comparison of the growth curves To obtain a more precise estimate, an idealised mathematical formula was used An idealised formula ... proportion P0 was calculated on each day where usable data of the sample culture were available and then averaged Competing interests The author(s) declare that they have no competing interests Authors'...

Ngày tải lên: 13/08/2014, 09:20

10 279 0
Tài liệu Retrieving a Single Value from a Query pdf

Tài liệu Retrieving a Single Value from a Query pdf

... The ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance ... performance improvement when compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore ... improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the result...

Ngày tải lên: 14/12/2013, 18:16

2 312 0
Tài liệu Pass a Dataset Back from an XML Web Service docx

Tài liệu Pass a Dataset Back from an XML Web Service docx

... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... once again checks the username and password by calling the TestUserMethod of the Web Service If the username and password check out, then the GetUserInfo method is called, passing the username ... username once again The first table from the returned dataset is assigned to the DataSource property of dgUsers Listing 13.6 frmHowTo13_4.vb: Retrieving a Dataset from a Web Service Private Sub btnLogin_Click(ByVal...

Ngày tải lên: 24/12/2013, 06:17

4 284 0
Tài liệu Getting a Sequence Value from Oracle pdf

Tài liệu Getting a Sequence Value from Oracle pdf

... creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all sequence definitions are always available ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... Example 4-7 File: OracleSequenceValuesForm.cs // Namespaces, variables, and constants using System; using System.Configuration; using System.Windows.Forms; using System.Data; using System.Data.OracleClient;...

Ngày tải lên: 21/01/2014, 11:20

4 338 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA ... ttcagacctg ttcagacctg 40 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg...

Ngày tải lên: 12/02/2014, 10:20

9 497 0
Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf

Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf

... “Voices of Fear and Safety” Women’s ambivalence towards breast cancer and breast health: a qualitative study from Jordan Hana Taha1,2,3* Email: hana.taha@ki.se Raeda Al-Qutob4,5 Email: raeda@johud.org.jo ... Foundation, Amman, Jordan Abstract Background Breast cancer is the leading cause of cancer mortality among Jordanian women Breast malignancies are detected at late stages as a result of deferred breast ... All the FGDs were moderated by the PI in Arabic Each lasted about 50–60 minutes The FGDs were all audio-taped and an Arabic speaking research assistant attended to observe and take notes The tape...

Ngày tải lên: 13/02/2014, 06:20

19 513 0
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It

Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It

... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... to a great many platforms that are ever-evolving Your ability to understand the foundational languages, C and C++, makes you infinitely more marketable and adaptable across a wide range of platforms ... That said, a great many coders work in the casual and social space using only ActionScript (Flash) or Java/JavaScript In recent years, individuals proficient in these languages have been more and...

Ngày tải lên: 13/02/2014, 17:23

304 1,7K 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... sequence was obtained from the single charged y-fragment ions (…) and the b-fragment ions (– –) Calculated from the b1 fragment and the y 28 fragment, the N-terminal amino acid consists of asparagine ... For the isolation of P40, the mL supernatant were incubated with the prepared magnetic beads (see previous paragraph) overnight at °C with gentle agitation After magnetic separation, the beads ... asparagine at position 26 and the arginine at position 455 we calculated for P40 a molecular mass of 44.873 kDa As the molecular mass of P40 in protein extracts, measured by SDS ⁄ PAGE is about...

Ngày tải lên: 19/02/2014, 18:20

9 559 1
w