md fostel jm 2004 toxicogenomics and systems toxicology aims and prospects nat rev genet 5 936 948

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08

... liver injury 50 iii 2 .5 Isolation of liver mitochondria 50 2.6 Determination of mitochondrial GSH 52 2.7 Determination of nitrite/nitrate levels 53 2.8 Detection of ... carbonyls and 3-nitrotyrosine adducts 53 2.9 Two-dimensional Difference Gel Electrophoresis 55 2.9.1 Labelling with cyanine dyes 55 2.9.2 Isoelectric focusing and two-dimensional ... my Ph.D and life Professor Chung has always been positive, and he gave me many opportunities, supported and encouraged me in bad times And that was how I was touched by his sincerity and patience,...

226
1.8K
0

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Ngày tải lên : 19/02/2014, 13:20

... 7.72 a In the presence of UFH k506 · · · · 1 05 1 05 106 106 1.17 3.24 1. 65 2.13 k306 · · · · 108 106 108 106 1 .55 5. 93 3.86 9.64 k¢306 · · · · 106 1 05 106 1 05 k506 2.17 · 106 NDa 3.38 · 106 3.13 ... phospholipid vesicles ( 25 lM) and wild-type APC were incubated at 37 °C in 25 mM Hepes (pH 7 .5) , containing 150 mM NaCl, mM CaCl2, and mgÆmL)1 BSA in the absence and presence of 25 IUÆmL)1 UFH Aliquots ... clashes against FVa and/ or could be very close to negatively charged FVa residues Asp513, Asp578 and Asp577 and/ or Asp 659 -Asp660-Asp661-Glu662-Asp663 (Fig 7A) Contact between FVa and APC loop 148...

13
654
0

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20

... 63104 9207 11.8 (39.3) 13.6 (2.8) 6.2 (5. 0) 99.3 (92 .5) 17 450 3.9 (5. 0) 20.6 (11.7) 3.7 (1.9) 97.7 (82.6) 43. 85 1. 95 43. 85 1 .55 (1.99–1. 95) (1 .58 –1 .55 ) 18 .5 (22.2) 14.7 (11.0) 23.3 (36.8) 20.2 ... cytochrome c2 2 454 J A R Worrall et al 44 45 46 47 48 49 50 51 52 53 54 55 isolated from Rhodobacter capsulatus determined at 2 .5 ˚ A resolution J Mol Biol 220, 673–6 85 Garau G, Geremia S & Randaccio ... )2.7 u⁄w )90 .5 ⁄ 138 .5 )129.7 ⁄ 142.8 )87.6 ⁄ 2.3 )160 .5 ⁄ 154 .9 )129.9 ⁄ )9.1 FEBS Journal 272 (20 05) 2441–2 455 ª 20 05 FEBS J A R Worrall et al X-ray and unfolding studies of cyt c -55 0 mid-point...

15
509
0

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Ngày tải lên : 08/03/2014, 16:20

... D14-SR (59 %), Saccharomyces cerevisiae D14-SR (55 %) (Fig 1), and other sterol reductases [50 % and 49% similarity to human and A thaliana sterol D7-reductases, respectively, and 44% to S cerevisiae ... accession nos BE 756 766, BE 756 734, BE 754 556 and AW427392) [34] The bovine cDNA was synthesized by RT-PCR using synthetic primers based on the EST sequences, cloned into the pCR2.1 vector, and sequenced ... 40 UámL)1 of RNase inhibitor, 2 .5 mM dNTP, 0.2 mM oligo-dT 15 18mer, and 200 U of M-MLV reverse transcriptase First-strand synthesis was performed at 42 °C for 45 and then the enzyme was inactivated...

8
493
0

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel ﬂuorescent probe pdf

Ngày tải lên : 16/03/2014, 11:20

... Calcd for C8H9ClO2: C, 55 .67; H, 5. 25; Cl, 20 .54 Found: C, 55 .41; H, 5. 43; Cl, 20.47 excitation and emission slit were set to 3 .5 and 3 .5 nm, respectively Preparation and staining of RAW264.7 ... penicillin, and 1% streptomycin at 37 °C (w/v) in a 5% CO2 ⁄ 95% air incubator MCO-15AC (SANYO, Tokyo, Japan) The concentration of counted cells was adjusted to · 106 cellsÆmL)1 and cells were passed and ... 4 85 ⁄ 55 9 nm against a reagent blank at the same time The 1732 Acknowledgements This work was supported by Program for New Century Excellent Talents in University (NCET-04–0 651 ), the National Natural...

9
401
0

Báo cáo khoa học: Identiﬁcation of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Ngày tải lên : 23/03/2014, 11:20

... putative protein MCA 259 0 and the translation start site of MopE Sequence analyses including the MCA 259 0, mopE and upstream nucleotides of MCA 259 0, revealed a candidate promoter region 5 of the potential ... MCA0421 and MCA0423, annotated as a cytochrome c 553 o family protein and cytochrome c 553 o, respectively (data not shown) [11,22] Discussion In this study, we show that the predicted ORF (MCA 259 0) ... identiﬁed Both of these proteins have previously been described as multi-c-heme cytochromes (cytochrome c 553 o and cytochrome c 553 o family protein) of M capsulatus, and the respective genes are clustered...

12
392
0

Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Ngày tải lên : 07/08/2014, 20:23

... 06-Co27,ces 06-Co 75 ,ces 06-Co49 selcyc 53 :1* *margorp RCP )pb( stcudorp deifilpma fo eziS 2401 019,017,726 079,018,0 95 513, 352 ,022 972 612 AGATGTCTTGGAAGCCAATTAATG :esrever ATCGGTATTTAACTAGCCCTGAAA ... ni pb 51 3 dna , 352 ,022 fo nocilpma na decudorp eneg eht fo gnidnib noiger -X ehT smraf morf setalosi ni deton saw msihpromylop eneg dna ,ylevitcepser ,smraf dna ,5 ,5 morf setalosi dna ,51 ,21 ... snixotoretne fo tnemevlovnI G aniL ,J enneitE ,M seB ,F hcsenednaV ,G nozoC ,S duarraJ 01 52 75- 32 75 ,771 ,59 91 loiretcaB J 4 /52 38 fo nisylotua rojam eht fo sisylana lanoitcnuf dna noitaziretcarahc raluceloM...

4
138
0

Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Ngày tải lên : 20/01/2014, 22:20

... diversify research exchanges and cooperation between Asia and Europe; c) Expand and diversify speedier and more powerful telecommunication connections between Asia and Europe - Quoted from the ... ICT, IR, 15 TEIN Initiative: Objectives a) Contribute to enhancing exchanges and cooperation between Asia and Europe through increased and more effective information flows; b) Enhance and diversify ... 45Mbps ATM SW Port & Local Loop: 45Mbps for temporary bandwidth ATM SW VBR 2Mbps - PCR=4Mbps - SCR=2Mbps Port & Local Loop: 34Mbps for temporary bandwidth Cable Path - APCN+SMW3 Temporary bandwidth...

30
362
0

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Ngày tải lên : 16/03/2014, 18:20

... (whiA1) 60 ± 15b 350 ± 25c 63 ± 14b 350 ± 25c 460 ± 90b 1000 ± 60b 47 ± 15b Not detectableb Not detectableb 60 ± 15c High M3CVIII 200 ± 75b 450 ± 45c 189 ± 20b 340 ± 28c 55 0 ± 60b 1730 ± 150 b 18 ± ... Biochemistry 34, 14741–14 751 Achhammer, G., Winkler, A., Angerer, B & Holler, E (19 95) DNA polymerase d of Physarum polycephalum Curr Genet 28, 53 4 54 5 Doerhoefer, S., Khodyreva, S., Safronov, I.V., ... in cytoplasmic extracts without (m) and after incubation with Lambda protein phosphatase (j); one relative unit ¼ 1 05 · A490/A5 95 (A490 ELISA readings, A5 95 protein readings according to the...

7
325
0

Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Ngày tải lên : 23/03/2014, 06:20

... (.60-.69) 26 65 (23 95- 2894) 21 .5 (18.0 - 25. 0) 57 ( .55 - .58 ) 64 (.62-.66) 52 ( .51 - .54 ) 62 (.60-.64) 40 (.38-.43) 65 ( .59 -.70) 2629 (24 25- 2834) 15. 9 (13 .5 - 18.3) 58 ( .57 - .59 ) 65 (.64-.67) 53 ( .52 - .55 ) 63 ... 30.4) 57 ( .55 - .59 ) 65 (.63-.68) 52 ( .50 - .55 ) 62 (.61-.64) 37 (.33-.41) 63 ( .58 -.69) 2490 (2294-2687) 23 .5 (19.8 - 27.2) 57 ( .56 - .59 ) 65 (.63-.67) 53 ( .51 - .54 ) 63 (.61-.64) 39 (.36-.42) 65 (.60-.69) ... 90 (0 .56 ) 90 (-0.92) 2179 1. 25 (2.08)** 1.03 (1 .50 ) 1.10 (0 .57 ) 1.34 (1.41) 54 (3. 05) *** 1.08 (0. 35) 1.00 (0.00) 69 (1.87)* 91 (0. 75) 2179 -1 157 .64 -944.89 * Significance at *** 1%, ** 5% , and...

53
369
0

Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the ﬂounder Platichthys stellatus pptx

Ngày tải lên : 29/03/2014, 08:20

... RTFEVNAHPDIL, SADQLLQQAL and SEGRLHFAGEHT were found at positions 56 7–602, 636–6 75 and 152 4– 155 9, respectively (Fig 4) The initial codon, ATG, was found at positions 102–104, and the open reading ... forward primer 5 -GAAGTTTCTCTACGGACTGC-3¢ and the reverse primer 5 -CAACCATCGATTGTGTCCAG-3¢ The betaactin primer pair (forward primer 5 -CATGTACGTTGC CATCCAAG-3¢ and reverse primer 5 -TCTCAGCTGTGG ... number AF1 354 99) Ampliﬁcation was carried out using AmpliTaq Gold DNA polymerase (Applied Biosystems) under the following conditions: 95 °C for 10 min; 35 cycles of 95 °C for min, 55 °C for and 72...

13
423
0

The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

Ngày tải lên : 28/06/2014, 17:20

... profits and patriotism; enriching one's self and philanthropy; getting all the law allows and justice; taking advantage of the other fellow and honesty; becoming engrossed in acquisition and love ... game, and this involves conformity with a standard, a standard of giving good value for what one gets We must next distinguish between gross profits and net profits The merchant or manufacturer naturally ... of earning and saving a surplus, the obligation would still be there We owe a similar debt to our state and to our city or district And nearer still comes the duty to one's family and to one's...

109
350
0

The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

Ngày tải lên : 28/06/2014, 19:20

... management of milking See Dairy Comparative value of oxen and 52 52 52 53 54 55 56 57 60 61 61 horses 190 Churns 69 Dairy, the Dairy—selection and management of cows milking properties of milk variations ... Cleveland bay, Belfounder Eclipse, American points of habits breeding management of colts breaking longevity, feeding Diseases glanders 140 142 143 143 144 1 45 141 146 147 148 149 150 151 154 154 ... sprain of the coffin-joint— ringbone enlargement of the hock 155 curb bone-spavin—swelled legs 168 170 156 158 159 162 164 164 1 65 166 166 167 168 grease setons founder—poison from weeds inflammation...

794
2.7K
0

Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx

Ngày tải lên : 07/08/2014, 10:21

... 140 120 100 20 10 80 0 .5 1.0 1 .5 2.0 2 .5 3.0 3 .5 4.0 4 .5 5.0 5. 5 Damage degree 60 0 .5 1.0 1 .5 2.0 2 .5 3.0 3 .5 4.0 4 .5 5.0 5. 5 Damage degree Fig The correlation between Mg and Ca content in the ... 6.94 25. 5 ± 1 .50 154 .00 ± 4.00 98.00 ± 18.78 114 .50 ± 3 .50 168.00 ± 45. 00 25. 00 ± 10.61 23 .50 ± 1 .50 Hanušovice H Ae/Ep Bs 3.36 ± 2.96 8 .50 ± 3.49 13.44 ± 11.98 94.71 ± 55 .06 27.82 ± 13. 35 21.63 ... ± 7. 05 194.43 ± 108 .56 114.18 ± 33. 45 106. 75 ± 28.69 177.00 ± 68 .52 26.27 ± 8.13 21. 25 ± 4.74 Javorník H Ae/Ep Bs 9.00 ± 0.00 8.83 ± 5. 78 6. 75 ± 1. 75 69.00 ± 10.00 32.00 ± 15. 12 25. 50 ± 0 .50 222.00...

12
529
0

Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf

Ngày tải lên : 08/08/2014, 01:22

... were then washed three times with 50 mL aliquots of distilled water by resuspension and filtration Samples (50 0 mg) were cooled to (24, 0, 5, –10, –20 and –30 °C) and potassium release into distilled ... glutamine, µM 2,4-D and 2. 25 µM benzyladenine 2.1.2 Sitka spruce (Picea sitchensis (Bong.) Carr.) Sitka spruce ECs were raised from immature embryos of sitka spruce clones and one cell line (57 4F) was ... proline and temperature, and of the interaction between them (p < 0.00 05) , with a very highly significant effect of proline at each temperature Similar results were seen for sitka spruce and oak...

4
338
0

Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps

Ngày tải lên : 08/08/2014, 18:21

... (1 958 -1987) and to build a mathematical simulation allowing a quantitative The permanent plots were located in four main stand types: i) an upland stand, site index I-II, aged between 55 and 85 ... reductions of growth and even dieback The most important increment losses were observed in the upland and solonetz stands, and the lowest in the floodplain and riverbank stands Since the crowns ... forest stands Nauchnye Trudy MLTI 15, 19-29 [in Russian) Yerusalimov EN (19 65) Variation in increment in a mixed oak stand after damage by leaf-eating insects Lesnoi Zhurnal 6, 52 -55 [in Russian]...

6
263
0

Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Ngày tải lên : 08/08/2014, 19:21

... chlorophyll content and age of papaya Photosynthetica 16, 52 0 -52 5 Powles SB (1984) Photoinhibition of photosynthesis induced by visible light Annu Rev Plant Physiol 35, 15- 44 Schulze ED, Hall ... (1987) as: ), o (F (1 35, 230, 460, 59 0, 1300 and 1 750 μmol ) -1 s Steady-state fluorescence (F) and maximal fluorescence following a saturating PFD -2 m flash (F were recorded and used to compute ... F m and an increase in F (Demmig and Björkman, 1987) This finding clearly distinguishes the reactions observed here from the diurnal and reversible decreases in F , m F and F noted under natural...

13
402
0