... HTLV-4 are associated with any particular disease such as leukemia The amino acid sequence and the functional analysis of HTLV-3 Tax3 showed that Tax3 has a functional PBM, and is capable of interacting ... 80 80 Transformation (Number) 60 40 20 40 20 Tax 224 Tax 232 Tax Tax 300 Tax2B Tax2B Tax 207 Tax300 D) Tax 154 Tax232 Tax1 Tax224 Tax 207 Tax207 Tax 184 Tax184 Tax154 Tax1 Tax1 Tax 154 Tax207 B) ... region plays a crucial role in the increased transforming activity seen with Tax1 relative to Tax2, mostly through the activation of the noncanonical NF-κB/p100 pathway Taking into account the fact...
... where m = for Case and m = for Case The interval enclosures for all state variables and the initial approximations xapp,1 (t) and xapp,2 (t) are shown in Fig In the considered time span, the improved ... they are fairly efficient for exactly known initial states and parameters, they are sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameters which have ... 2 the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated...
... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622,...
... estimate for calculating the limit of detection (LOD) of analytical methods MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... some peaks might only appear in a few samples, while being fully undetectable in others Also, the available algorithms for aligning mass spectra are not time-linear and are hardly applicable for...
... same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The airgap length is constant and large since the magnets ... Indeed, the nonlinear feedback linearization scheme is based on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal ... self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb , and arc the rotor fluxes induced in the stator phases are The...
... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... to the measured leakage values with graphpad prism software Gas exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt ... of the reduced cosubstrate NADPH For isomerization of fructose 6-phosphate, phosphoglucoisomerase was added 516 Mathematical modelling, parameter identification and simulation A mathematical model...
... acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one of the first antagonists that differentiated pharmacologically ... ease of synthesis, makes AuIB is present in intracardiac ganglia, or that the a3 b4* them particularly useful templates forthe design of receptors in intracardiac ganglia form a substantially optimized ... MS analysis and assay-directed fractionation [83] It has subnanomolar potency at the a3 b2 nAChR and is 200-fold less active on the a7 nAChR (Table 1) AnIB is sulfated at tyrosine 16 and has,...
... In particular if X is a set of reals of cardinality ℵ1 , then X serves as a single-element basis forthe class of uncountable separable linear orders PFA is a strengthening of the Baire Category ... an equivalent formulation due to Bagaria [2]: BPFA: If φ is a formula in language of H(ℵ+ ) with only bounded quantifiers and there is a proper partial order which forces ∃Xφ(X), then H(ℵ+ ) already ... for applying PFA which may be relevant to solving other problems I would like to thank Ilijas Farah, Jean Larson, Paul Larson, Bill Mitchell, and Boban Veliˇkovi´ for carefully reading the paper...
... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society, Environmental ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 1028 utilized forthe primer ... and the amplification product was 378 bp The primers for GAPDH were 5¢-TGCACCACCAACTG CTTAG-3¢ (forward) and 5¢-AGAGGCAGGGATGATGT TC-3¢ (reverse), and the amplification product was 177 bp Preparation ... primers forthe second PCR primers were 5¢-CCGCCATGGATCCCAGCAACTGGAGCAGC-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTCCAC-3¢ (reverse) The amplification product of the second PCR was 208 bp The reaction...
... Our data base is freely available as a MongoDB database, which can easily be interfaced with using APIs in various programming languages For information about how to obtain the database, please ... dominance relations are A dominates B, B dominates C and A dominates C This data set is much larger than any other data set used in the literature forthe sake of predicting organizational hierarchy ... out-performs the NLP-based approach even if we evaluate on a much smaller part of the gold standard, namely the part where an NLP-based approach does not suffer from having to make a random prediction...
... resonances at d 4.46, 4.94, 4.52, 4.91 and 4.62 were attributed to the t-Gal (GalI and GalII), 4-Gal (GalI*), 3-Gal (GalII*) and t-GalNAc (GalNAc) identified by linkage analysis Signals forthe ... of the other Hep3-glycoforms were obtained in an analogous manner (data not shown) and for all glycoforms the hexoses were found to be members of a linear chain attached to HepI (Table 3) Forthe ... [16] The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS...
... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... first and the third parameters are trigrams of T and B respectively The second and the fourth are lexical generation probabilities Probabilities (1) and (2) can be calculated from POS tagged data...
... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... Master Data File AMSAA Army Materiel Systems Analysis Activity ASL Authorized Stockage List AWCF Army Working Capital Fund CAA Center for Army Analysis CBO Congressional Budget Office CEAC Cost and...
... gateway: hosts trying to contact s would have their connections terminated at endpoint o, and the gateway would inspect the ADUs, and then make a decision about whether to forward them The reason ... inappropriate namespace or bearing the overhead of creating a new one; instead, with a flat namespace, all new network elements can be effortlessly incorporated The second message is that the extra naming ... bindings are thus accurate and appropriate even in the face of host mobility and service migration For instance, if the EID-to-IP mapping changes, then the transport layer can re-initiate an EID...
... al [2] and (b) side view of the PQ/SiNWs adsorption mechanism responsible forthe shrinkage of the gap Forthe same reason, the onset of the feature appearing at À0.5 V is presumably due to the ... SiNWs, as compared to Fig 1, is due to the presence of the molecular aggregates on top of the SiNWs which decreases the contrast between the SiNWs and the Ag surface The molecular aggregates form ... on the SiNWs modified Ag(1 0) surface Two filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape...
... probe was labeled and purified as described above A kb human b-actin cDNA fragment was used as the control probe and labeled with Ready-To-GoTM DNA Labelling Bead (–dCTP) (Amersham Pharmacia Biotech.), ... on the current amplitude of NaV1.2 Each individual data point in the histogram represents the peak inward current fora single oocyte Also shown are the mean (j) and standard deviation (bars) for ... as a probe The antisense single stranded DNA probe was synthesized using the Strip-EZTM PCR kit (Ambion, Austin, TX, USA), in the presence of antisense primer SB1-20 (5¢-TC AAACCACACCCCGAGAAA-3¢)...