make a portfolio site with wordpress

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

... Ichimiya S, Nakagawara A, Sakuma Y, Kimura S, Ikeda T, Satoh M, Takahashi N, Sato N & Mori M (2000) p73: structure and function. Pathol Int 50, 589–593. 23 Levrero M, De Laurenzi V, Costanzo A, ... cisplatin-damaged DNA: a clue to anticancer activity of cisplatin. FASEB J 12, 791–799. 30 Kasparkova J & Brabec V (1995) Recognition of DNA interstrand cross-links of cis-diamminedichloroplatinu- m(Ii) ... DNA binding to these targets caused by the DNA treatment with cisplatin. AB Fig. 3. Effects of DNA modification with cisplatin on p53(1–363) binding to various target sites: (A) , natural p53 DNA-binding...

Ngày tải lên: 19/02/2014, 05:20

14 598 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... (5Â- GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3Â); GLU H44 7A forward (5Â- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3Â), GLU H44 7A reverse (5Â- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3Â); GLU T46 2A ... forward (5Â- GAACAACTT AACAGATATGCCGGTTATT CCACCGGT GCC-3Â), GLU T46 2A reverse (5Â- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3Â); GLU H44 7A, D45 0A for- ward (5Â-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3Â), ... (Stratagene, La Jolla, USA). Plasmid pVT100L-Glu [38] was used as a template. The following oligonucleotides were used: GLU R1 5A forward (5Â-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3Â), GLU R15A...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
Best Practices for Developing a Web Site

Best Practices for Developing a Web Site

... the day was “Do you have a Web site? ” A well-designed Web site was a new and exciting marketing medium that businesses and users alike saw as a novel, nice-to-have tool. Fast-forward a decade and ... architecture: Site and content architec- ture defines the physical organization components (such as applications and databases) and content. Site administration, manageability, and security will greatly influence ... for a cheap and amateur- ish site will devalue your business and can do more harm to your professional image and reputa- tion than not having a Web site at all. Remember: Building a Web site might...

Ngày tải lên: 20/08/2012, 11:43

17 675 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... GW. Maxillary diastema: indications for treatment. Am J Orthod 1979 Apr;75(4):399-404 22. Dubuk AN, Selvig KA, Tellefsen G, Wikesjo UM. Atypically located paramolar. Report of a rare case. ... supernumerary teeth in a family unit with a normal karyotype: case report Francesco Inchingolo 1  , Marco Tatullo 2 , Fabio M. Abenavoli 3 , Massimo Marrelli 4 , Alessio D. Inchingolo 5 , Mattia ... University of Bari, Bari, Italy 3. Department of “Head and Neck Surgery”, Hospital “Fatebenefratelli”, Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... Nga K 1 1A 27 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: How good of you! An exclamation ... Nga K 1 1A 30 Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... stative or dynamic contrast, as it related to adjectives, is largely a semantic one, though as we have seen it also has syntactic implications. 2.2.2 Gradable and non- gradable adjectives According...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... on absorber plate of a solar air heater” 19th National & 8th ISHMT-ASME Heat & Mass Transfer Conference Jan. 3-5, 2008 JNTU Hyderabad, India [22] Tariq, A. , Keshav Kant and Panigrahi, ... Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan. 05-07. [2] Han J. C. “Heat transfer and friction ... International journal of Heat mass transfer, 14, 601-617,1971 [5] Kiml R. Mochizuki S. and Murata A. “Effects of rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage”....

Ngày tải lên: 05/09/2013, 16:10

12 831 0
Procedure to make a money bill

Procedure to make a money bill

... Bureau is working to solve the problem. (MUSIC) BARBARA KLEIN: Our program was written by Dana Demange and Shelley Gollust. Our producer was Brianna Blake. I’m Barbara Klein. STEVE EMBER: And ... programs are online with transcripts and MP3 files at voaspecialenglish.com. And you can find us on Twitter, Facebook and YouTube at VOA Learning English. Join us again next week for THIS IS AMERICA ... President Ulysses Grant and statesman Benjamin Franklin. STEVE EMBER: During the tour, visitors can learn many facts about money. For example, the average life span of a one-dollar bill is twenty-one...

Ngày tải lên: 18/10/2013, 04:11

4 367 0
Performing a Bulk Insert with SQL Server

Performing a Bulk Insert with SQL Server

... a XML bulk load operation. The example defines an optional error log file, where the default is an empty string meaning that no error log is created. You can bulk load data into multiple parent-child ... parent-child tables at the same time, a feature that is not available in the OpenXML Transact-SQL extension. For information about the XML Bulk Load component and its methods and properties, ... Customers table The sample uses a single XML file: Customers.xml Contains the data that is bulk loaded into the Customers table The sample code creates a bulk load object SQLXMLBulkLoad and sets...

Ngày tải lên: 20/10/2013, 12:15

5 395 0
Tài liệu Making a Portfolio pdf

Tài liệu Making a Portfolio pdf

... fancy shoelaces (for the handles) Ü Acid-free cardboard or matt board (usually offered in a wide selection of colors) Acid-free cardboard or matt board is generally available at framing or art ... Drawing People (2004): Winner of the Alpha-Penguin Book of the Year Award 2004, Alpha - Pearson Education – Macmillan, Indianapolis, IN, this 360 page book is available on various websites and ... International”. Her home-based art career included graphic design, and teaching recreational drawing and painting classes. As supervisor of her community’s recreational art department, Brenda hired and...

Ngày tải lên: 14/12/2013, 15:15

6 522 0
Tài liệu Loading a Windows PictureBox with Images Stored by Access as OLE Objects pdf

Tài liệu Loading a Windows PictureBox with Images Stored by Access as OLE Objects pdf

... System.Data; using System.Data.OleDb; private const int MSACCESSIMAGEOFFSET = 78; private DataSet ds; private OleDbDataAdapter da; private BindingManagerBase bm; // . . . private ... OLE image header that Microsoft Access adds to the image. The sample code contains six event handlers: Form.Load Sets up the sample by filling a DataTable within a DataSet with the Categories ... DisplayMsAccessImageForm_Load(object sender, System.EventArgs e) { // Create the DataSet. ds = new DataSet( ); // Create the DataAdapter and retrieve the Categories table. [ Team LiB...

Ngày tải lên: 14/12/2013, 18:16

5 433 0
w