make a new folder from some files

... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an...

Ngày tải lên: 08/03/2014, 16:20

... the termination and initiation codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce ... single-domain rhodanese We puried and characterized a protein from A aeolicus annotated as a hypothetical protein In vitro, it catalyses the transfer of sulfane sulfur from thiosulfate to cyanide ... The Aq-477 amino acid loop presents the motif of the catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bacteria, archaea and eukaryotes Aq-477 catalyses...

Ngày tải lên: 30/03/2014, 03:20

... Republic of China Author details Department of Mathematics, Honghe University, Yunnan, 661100, China 2Department of Mathematics, National Kaohsiung Normal University, Kaohsiung 824, Taiwan Authors’ ... YF, Shang, MJ, Qin, XL: An iterative method of solution for equilibrium and optimization problems Nonlinear Anal 69, 2709–2719 (2008) doi:10.1016/j.na.2007.08.045 Tada, A, Takahashi, W: Weak and ... Hirstoaga, A: Equilibrium programming in Hilbert spaces J Nonlinear Convex Anal 6, 117–136 (2005) Flam, SD, Antipin, AS: Equilibrium progamming using proximal-link algorithms Math Program 78,...

Ngày tải lên: 21/06/2014, 01:20

Ngày tải lên: 27/10/2014, 22:35

... Obama on a New Economy agenda As I was working on that piece with Michael, YES! magazine editors Sarah van Gelder and Doug Pibel suggested I a piece for YES! that would speak to the bailout passed ... and nature and the special character of America as a middle-class democracy, free from the extremes of wealth and poverty that I was led to believe characterized the world’s less advanced nations ... building, renewable energy, community capital, zero-waste manufacturing, and independent retail I am a member of the BALLE governing board AMIBA has paid particular attention to giving local independent...

Ngày tải lên: 01/11/2014, 19:19

... performance appraisals and Machiavellinism has not been widely researched Machiavellians can be distinguished from impression managers Machiavellians tend to employ manipulative strategies in dealing ... important today because knowledge is supplanting land, labor, and capital as the primary source of competitive advantage, and as such the ability to create new knowledge as well as to share existing ... appointments with various companies in Mumbai, vide their contacts I take this opportunity to specially thank “Kakukaka”, Prashant, Kalpesh, Jyotiben, Yogita, Nikita, Harshit, Hemali, Kajal and...

Ngày tải lên: 12/09/2015, 11:24

... create a new database, it does give you an idea of where you can see various databases in your system Now you will learn how to create a database in VS NET You can open the Create Database dialog ... right-click on the SQL Server instance to which you want to add the database-in this case, SHADRACH2-and then choose New Database Although both methods open the Create Database dialog box, the second method ... need to create a new database Click OK to complete the dialog box and create the new database How It Works Now you when you click on the plus sign for the new database, you will see branches in...

Ngày tải lên: 21/01/2014, 12:20

... data adapter ' and fill the data table Dim odaResults As _ New OleDb.OleDbDataAdapter("Select * From MyProdAndCat", BuildCnnStr("(local)", "Northwind")) odaResults.Fill(dtResults) Catch excp As ... Storing the SQL Statement in the lblSQLString Label to Display and Use Later Private Sub frmHowTo6_7_Load(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles MyBase.Load ' Build ... MessageBox.Show(excp.Message) Exit Sub End Try ' Assign the data table to the data grid's DataSource property Me.dgResults.DataSource = dtResults End Sub Figure 6.8 These results are based on a...

Ngày tải lên: 21/01/2014, 12:20

... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... 0.25 µm) The analytical condition were the same as described above with He as carrier gas, and interface temperature 260o C Components identification was carried out by comparing MS data with those ... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora,...

Ngày tải lên: 12/02/2014, 17:20

... 757–778 AAG AGC GCA ACT GAT AGT GCA TCC GCC ATC GAC GCA ATT AGC CTT GCT AGC AGT ACG AGG 613–630 822–839 706–723 466–483 AAG AGC AAA GAT GAT AGT GAT TAC GCC ATC CCA CAG ATT AGC ATC AAT AGC AGT CAG ... purpureus and F scutaria larvae sequences have a H64 also shared by A gambiae, A aegypti, T gigas, D melanogaster-2 and D melanogaster-3 sequences (data not shown) By contrast, R pachyptila amino acid ... cnidarian F scutaria Finally, we chose an outgroup comprising a- CAs from a cyanobacteria (Nostoc sp.) and three proteobacteria (Klebsiella pneumoniae, Erwinia carotovora ssp atroseptica and Neisseria...

Ngày tải lên: 18/02/2014, 16:20

... taipan snake Oxyuranus scutellatus (Os), and the boar Sus scrofa (Ss) Identical residues are on a black background, and similar residues are on a gray background The sea anemone unique asparagine ... isolated protein and the UcPLA2 cDNA are probably due to intraspecific variability, as mRNA was obtained from a single animal, whereas the protein was isolated from exudates of several U crassicornis ... Urticina crassicornis A Razpotnik et al A B Fig (A) Alignment of PLA2 protein sequences from: the sea anemones Urticina crassicornis (Uc), Nematostella vectensis (Nv) and Adamsia carciniopados (Ac),...

Ngày tải lên: 06/03/2014, 11:20

... were harvested immediately following irradiation and analysed for pyrimidine dimer formation Non-irradiated cells and cells irradiated through a naked quartz plate served as controls As can be ... in cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have ... amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, 17 different aminocyclohexenimines...

Ngày tải lên: 07/03/2014, 15:20

... Fig.2) amyAspka a- amylase amyAspnd a- amylase amyBacsp a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase ... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... emersonii Aspergillus awamori Aspergillus niger T21 Neurospora crassa AAB02927 AAT58037 BAA00331 AAB59296 AAB20818 BAA01254 L15383 BAA08436 CAA47945 AAA33386 AAF75523 AAE15056 AAR61398 BAD06004 AAP04499...

Ngày tải lên: 07/03/2014, 21:20

... molecular mass markers are indicated in kDa F 4¢-OMT activity towards the different assayed substrates, transformation products and kinetic analysis The enzyme became inactive when the assayed substrates ... of a specific methylated flavonoid phytoalexin, just as reported to occur in barley [28] In several plants, an accumulation of methylated flavonoids has been explained as a protection against pathogens, ... Plant Pathol 91, 119–135 14 Benavente-Garcia, O., Castillo, J., Sabater, F & Del Rio, J .A (1997) 4¢-O-methyltransferase from Citrus A comparative study in Citrus aurantium, Citrus paradisi and...

Ngày tải lên: 08/03/2014, 08:20

... pseudomonads Eur J Biochem 236, 689–696 Caumette P, Baulaigue R & Matheron R (1988) Characterization of Chromatium salexigens Sp-Nov, a halophilic chromatiaceae isolated from mediterranean salinas ... G75, by ammonium sulfate precipitation (50–70% saturation), and by chromatography on hydroxyapatite, where it was eluted at 25 mm phosphate from a 0–100 mm gradient Final purification was achieved ... receptor-like PTP-alpha revealed by an antibody against oxidized protein tyrosine phosphatases Proc Natl Acad Sci USA 101, 1886–1891 Tsujimura M, Dohmae N, Odaka M, Chijimatsu M, Takio K, Yohda M, Hoshino...

Ngày tải lên: 08/03/2014, 08:20

... b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 50 -GAAGCATA TCCACTATGAAGATGA-30 and 50 -TGAATACTCCCGTG ATTTCCTGTTG-30 ... Nishinomiya, Japan) Other chemicals were purchased from Wako Pure Chemicals (Osaka, Japan) and Nakalai Tesque (Kyoto, Japan) Customized oligonucleotide primers were synthesized by Amersham Pharmacia ... cells by guanidine thiocyanate/hot phenol extraction [24] Poly (A) -rich RNA was purified by an mRNA purification kit (Pharmacia), and a Luffa cDNA library was constructed using a lZAP-cDNA synthesis...

Ngày tải lên: 08/03/2014, 23:20

... GGCGCGACGCACGAAAATTACGC GTCTATTTTCACGCAAAGCACCCGGT AAACCGATTTGTACATCGCATTTTC CATTAATGGATATCGTTCCGATTCC firmed by sequencing (Invitrogen Biotechnology Co., Ltd, Shanghai, China) (Otsu, Japan) The ... Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli J Biol Chem 250, 4128–4133 38 Yagi T, Kagamiyama H, Nozaki M & Soda K (1985) Glutamate-aspartate transaminase from ... necessary to form lmolÆmin)1 of oxaloacetate The aromatic amino acid aminotransferases were assayed according to Mavrides and Orr [37] The assay was established for AAT except that aspartate was...

Ngày tải lên: 14/03/2014, 23:20

... regenerated biomass of C sorokiniana was reusable having sorption efficiency of 98.3% C sorokiniana immobilized on lu a sponge, as a compact immobilized biomatrix Aloysius, R., Karim, M.I .A. , Ariff, A. B., ... the availability of which reduces, becoming a limiting factor at saturation (de Rome and Gadd, 1987; Rai and Mallick, 1992) Equilibrium sorption isotherms for free and immobilized algal biomass ... and immobilized cells was 89.7% and 93.5% within min, and in 60 was 92.7% and 97.9% These observations indicate that C sorokiniana has active and efficient sorption a nity for Cd2þ The first rapid...

Ngày tải lên: 15/03/2014, 23:17

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... 667–674 239 CAGCTgtaag/tccagGTCTG A B C D 163 243 671 261 CAGCTgtaag/tccagGTCTG GGGCGgtgag/tccagTTGAA AGGCGgtgag/caaagCTGAA GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT...

Ngày tải lên: 17/03/2014, 03:20

... not affect the brain Na channel Nav1.2 (in contrast to the antimammal a- toxins), they are most active on the cardiac Na channel subtype (more than the antimammal and anti-insect a- toxins, Lqh2 and ... labeled Lqh2 or Aah2 to rat brain synaptosomes (Fig 6) For antimammal and anti-insect a- toxins, the data points showing the relationship between LD50 and Ki values appear roughly aligned on a ... pharmacological and structural arguments, and used a comparative approach to discuss the features that differentiate this type of toxins from classical- and antiinsect a- toxins Long ignored as...

Ngày tải lên: 17/03/2014, 11:20