... two important facts First, the chick linker histones can – like their human counterparts – be associated with speci c and different functions; and, second, the cells, being erythrocytes, are terminally ... genes, and 3686 Epigenetic mechanisms in disease As speci c pathologies (syndromes) can be associated with problems in the epigenetic machinery, and epigenetics is fundamental to chromatin structure, ... evidence emerging is that the H1 variants have speci c functions First, individual H1-variant knockout mice gave rise to speci c phenotypes, with distinct effects on gene expression and chromatin...
Ngày tải lên: 18/02/2014, 08:20
... Individuals with CD4 counts 499 cells/mm3 The lack of association between vitamin A and CD4 counts could ... (UAB), and the Committee on Human Research, Publication and Ethics, Kwame Nkrumah University of Science and Technology (KNUST) College of Health Sciences, Kumasi, Ghana Data and blood sample collection ... grains and nuts under hot, humid and unsanitary conditions Acute and chronic exposures to aflatoxins compromise immunity and enhance macro- and micro-nutrient malnutrition and neonatal jaundice [19,22,23]...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: "Cartilage markers and their association with cartilage loss on magnetic resonance imaging in knee osteoarthritis: the Boston Osteoarthritis Knee Study" doc
... recognize cleavage epitopes called COL2-3/4Clongmono (also known as C2 C) and specific for type II collagen [14], and collagenase cleavage epitopes called COL2-3/4Cshort or C1 , 2C, which detect cleavages ... reflect cartilage synthesis (CPII) and those that reflect cartilage degradation (Col2:3/4Clong [C2 C], Col2:3/ 4Cshort [C1 , 2C] , and Col2CTx) We performed the same analytic approach as above with ... CPII C1 , 2C Col2CTX/Cr ratio C2 C C2 C, collagenase cleavage of triple-helical type II collagen; Col2CTx, crosslinked peptides from the C- telopeptide domain of type II collagen; COMP, cartilage...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Biochemical markers of bone turnover and their association with bone marrow lesions" docx
... bone-specific alkaline phosphatase; NTx/Cr, type I collagen N-telopeptide corrected for urinary creatinine; SD, standard deviation Ln-NTx exhibited a significant association with BMLs, with the ... associated with the presence of BMLs Bone is a specialized connective tissue with an extensive extracellular matrix that has the unique ability to become calcified, thereby forming, in conjunction with ... associated with increased insulin-like growth factor types I and II and transforming growth factor beta in cortical bone from the iliac crest Possible mechanism of increased bone density and...
Ngày tải lên: 09/08/2014, 13:21
báo cáo khoa học: "Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus" potx
... GTTGTAGAGACACAGCCACCTTC ET3-R ET4 PT5-L CGGCAGTTTTCCGGTGAC ET4-L GTTGTAGAGACACAGCCACCTTC ET4-R TTCGTCGCCGGAGTTTGG S-1300 TTCCGACCAATCCACTCAAC PT5-R ET3 ATGTTCGCTGGCATACCTAG PT1-R PT5 PT1-L Product(bp) ... are necessary to validate the association Furthermore, alteration of sucrose concentration will provide convincing evidence However, the current characterization of allelic variation and association ... linkage, association, and expression analyses and wrote the initial draft of the manuscript CM conceived of and supervised the overall research XW participated in the sequence amplification and alignment...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "Getting out and about in older adults: the nature of daily trips and their association with objectively assessed physical activity" doc
... Research Council, Research and Development Office for the Northern Ireland Health and Social Services, Chief Scientist Office, Scottish Executive Health Department, Welsh Assembly Government, and ... much research has been conducted on structured programmes of physical activity [7] much less is known about daily patterns of movement and their association with overall levels of physical activity ... medical practices distributed within the boundaries of a large city in the UK (Bristol) Practices were stratified by amenity access (the number of patients within each practice from areas with...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo sinh học: "Casein haplotypes and their association with milk production traits in Norwegian Red cattle" pot
... breeds are s1-casein B (here denoted CSN1S1_192*A) and C (CSN1S1_192*G), -casein A1 (CSN2_67*A), A2 (CSN2_67 *C) and B (CSN2_122 *C) , and -casein A (CSN3_136 *C) , B (CSN3_136*T) and E (CSN3_155*G) ... haplotype block constructed for CSN1S1-CSN2-CSN1S2 Figure 10 Haplotype effects on PY and MY for a haplotype block constructed for CSN1S1-CSN2-CSN1S2 Only haplotypes with population frequency above ... between SNPs within CSN2 and CSN1S2, and protein and milk yields The most significant results were found for CSN2_67, CSN2-BMC_9215 and CSN1S2BMC_17192 When fitting CSN2_67 as fixed effect in a multiple...
Ngày tải lên: 14/08/2014, 13:21
Characterizing iris surface features and their association with angle closure related traits in asian eyes
... surface features 36 Table 3.1 Comparison of clinical and anterior chamber characteristics of included and excluded eyes 50 Table 3.2 Demographic and clinical characteristics of study participants ... damage to the optic disc is observed Primary angle closure glaucoma (PACG) – PAC with evidence of glaucomatous optic neuropathy Acute primary angle closure (APAC) occurs when sudden closure of the ... iris.23 Sihota et al (2001) described that upon iridotrabecular contact, some pigments get displaced and accumulate in the trabecular spaces and within the cells Such contact may also lead to a noninflammatory...
Ngày tải lên: 30/09/2015, 10:11
Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps
... Laboratory and Clinical Evaluation of HCV Infection A serum specimen was collected from each patient and was tested positive for HCV antibody (Anti-HCV) using and 3rd generation commercial Enzyme ... certain European counties such as in Germany and Greece, where the prevalence of HCV genotypes 1b and have decreased and genotypes 1a, 3a, and increased Such changes were not noticeable in Luxembourg ... children with HCV infection; changing distribution and correlation with clinical features and outcome Gut 2005, 54:852-857 26 La Torre G, Miele M, Mannocci A, et al: Correlates of HCV seropositivity...
Ngày tải lên: 12/08/2014, 02:20
GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC
... ♂Piétrain with CC halothane genotype (PiDu50), Eight ♀(Piétrain × Duroc) × ♂ Piétrain with CC halothane genotype (PiDu75), Five Piétrain with CC halothane genotype (PiCC), Six Piétrain with CT halothane ... genetic background (P
Ngày tải lên: 28/08/2013, 11:59
Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx
... for each single country Where we find cointegration we study the lead-lag dynamics by means of the bivariate VECM and we analyse the statistical and economic significance of the coefficients and ... severe depreciation of the bond’s currency in case of a credit event This currency mismatch introduces an element of exchange rate risk into the pricing of the contract Finally, counterparty ... considers this adjustment process is the Vector Error Correction Model (VECM)20 The Vector Error Correction Model is specified as follows: p CDS t (Z t ) j CDS q t j p BondSpread t (Z t ) j CDS...
Ngày tải lên: 16/02/2014, 02:20
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx
... treatment No Cbl Without NADPH or MSR With MSR With NADPH and MSR AqCbl Without MSR or NADPH With MSR With FMN domain With NADPH and MSR With NADPH and CPR With NADPH and nNOSred MeCbl Without MSR ... reducing hMS and returning it to the catalytic cycle The turnover of hMS increases as MSR is reduced to the one-electron, two-electron and fourelectron reduced states, reflecting a higher concentration ... (c) MSR enhances hMS stability with both AqCbl and MeCbl, and (d) CPR and nNOSred are unable to affect hMS stability, despite having AqCbl reductase activity Therefore, the incorporation of cobalamin...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Plant a-amylase inhibitors and their interaction with insect a-amylases ppt
... acarviosine-glucose, hibiscus acid and the cyclodextrins (Fig 2A) The two hibiscus acid forms, puri®ed from Roselle tea (Hibiscus sabdaria), the acarviosine-glucose, the isoacarbose and a-, b- and c- cyclodextrins ... The degree of social acceptance of transgenic crops depends on consumer reactions, which in turn depend on the social context of the transgenic technology Although rigorous speci cations have been ... activity CAI PAI Zeamatin V.unguiculata C cajan Z mays None HSA and PPA None activity SIa1, SIa2 and SIa3 S bicolor HSA (low) Callosobruchus maculatus Callosobruchus chinensis Diabrotica virgifera...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx
... 5¢-GGCCCAG GTGACTCAGCTATT-3¢; reverse, 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; ... 5¢-GGACCAGGCA GTTGGCTCTA-3¢), JUN (forward, 5¢-GGATCAAGGC GGAGAGGAA-3¢; reverse, 5¢-TCCAGCCGGGCGATT-3¢), PLAU (forward, 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), ... 5¢UGACUUCCCUGGCCUAUUUUU-3¢, 5¢-ACAUUGAGC UCCUCUCUUGUU-3¢, 5¢-GAUAAGGUUGCUUCAGU UAUU-3¢ and 5¢-ACAGUACGCUAUGAAACUAUU-3¢, respectively As a negative control, we used an NT siRNA (5¢-UAGCGACUAAACACAUCAA-3¢) or a RISC-free...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: "Joint Identification and Segmentation of Domain-Specific Dialogue Acts for Conversational Dialogue Systems" doc
... those for the utterances annotated with multiple dialogue acts Each dialogue act class typically contains several more speci c dialogue acts that include domain -speci c semantics (for example, there ... 77 distinct labels, with each label corresponding to a domain -speci c dialogue act, including some semantic information Each of these 77 labels is composed at least of a core speech act type (e.g ... Tj,i and pick the best returned class (dialogue act label) Cj,i (and associated score, which in the case of our maximum entropy classifier is the conditional probability Score(Cj,i ) = P (Cj,i...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx
... oligonucleotides are as follows: for ES10 5¢-ATCAGCTTAGCAATGGGCTTG CTA-3¢; ES4 5¢- TCGGCAGCACTACATTGTCAAC-3¢; ES3 5¢- GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ ... rat liver cDNA, anchor primers AP1 and AP2 (Clontech, Palo Alto, CA, USA), and gene speci c primers 5¢-AGGCCCAGGAACGGGATTCC-3¢ for 5¢ RACE and 5¢-GATAAATCTGAGGTGGTCTACAAG-3¢ for 3¢ RACE were used ... TTCCTGGGCCT-3¢ Both the 5¢- and 3¢-RACE products were cloned and sequenced The complete cDNA for this carboxylesterase was cloned by amplifying rat liver cDNA with the primers 5¢-CTGAGATTCAACCATGCCTTTGGC-3¢...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx
... 5¢-CCTGTGGAACTCGTCGACCGCTTCGATTCCG 5¢-GAAAAGCAAGAGTTACCCCCGCGTTTATGGCACAGGAAG 5¢-CTTCCTGTGCCATAAACGCGGGGGTAACTCTTGCTTTTC 5¢-GCTTGAGTTCCAGGCTGTGAGCATCAATGGAGATAAGTATC 5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGC ... 5¢-CCCACAGGTATGCGAGTGGTGGAATTCACGG 5¢-CCGTGAATTCCACCACTCGCATACCTGTGGG 5¢-CCACAGGTATGAGAGTGTTGCAATTCACGGAATCGAAAGG 5¢-CCTTTCGATTCCGTGAATTGCAACACTCTCATACCTGTGG 5¢-CGGAATCGAAGCGGTCGACGAGTTCCACAGG 5¢-CCTGTGGAACTCGTCGACCGCTTCGATTCCG ... 5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGC 5¢-GGCTTGAGTTCCAGAATGTGGCCATCAATGGAGATAAG 5¢-CTTATCTCCATTGATGGCCACATTCTGGAACTCAAGCC 5¢-AATGGCTTGAGTTCCAGGCTGTGGCCATCAATGGAGATAAGTATC 5¢-ATACTTATCTCCATTGATGGCCACAGCCTGGAACTCAAGCCATTC Combination...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: The bI/bIII-tubulin isoforms and their complexes with antimitotic agents pptx
... Taxol: a new and effective anti-cancer drug Anticancer Drugs 2, 519–530 Horwitz SB, Cohen D, Rao S, Ringel I, Shen HJ & Yang CP (1993) Taxol: mechanisms of action and resistance J Natl Cancer Inst ... organic and bioorganic molecules using molecular mechanics J Comput Chem 11, 440–467 32 Weiner SJ, Kollman PA, Case DA, Singh UC, Chio C, Alagona G, Profeta S & Weiner P (1984) A new force field ... molecular mechanical simulation of nucleic acids and proteins J Am Chem Soc 106, 765–784 33 Hasel W, Hendrickson TF & Still WC (1988) A rapid approximation to the solvent accessible surface areas...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Crystal structure of RNase A tandem enzymes and their interaction with the cytosolic ribonuclease inhibitor potx
... [19] Tandemization considerably enhances endocytotic internalization into the cells [20], and potentially impedes binding by RI Despite their clear cytotoxic action and their dimeric structure, ... Gaetano S, Arciello A, Garbi C, Piccoli R, D’Alessio G, Vecchio G, Laccetti P & Santoro M (2003) Antineoplastic ribonucleases selectively kill thyroid carcinoma cells via caspase-mediated induction ... and kinetic characterization of recombinant porcine ribonuclease inhibitor expressed in Saccharomyces cerevisiae Biochemistry 29, 8827–8834 11 Dickson KA, Haigis MC & Raines RT (2005) Ribonuclease...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot
... of each DNA sample were used in PCR analysis in the presence of 40 pmol each of the Rnf33 -speci c RNF33-ChIP-F (5¢-AG GGCATAAAGGAGGGCAGGGAAC-3¢) and RNF33ChIP-R (5¢-CATCAGCTTCCCTTATGAGAACAG-3¢) ... Bioresource Collection and Research Center (BCRC), Hsinchu, Taiwan; the cell lines were originally obtained by BCRC from the American Type Culture Collection (ATCC, Manassas, VA, USA) for maintenance ... 848 K.-B Choo et al sequence (underlined) that were used in the competition experiments were: wild type, 5¢-AGGTCTGGGAATTCCC CCCGGA-3¢; and mutant 5¢-AGGTCTGGGAATagggCCC GGA-3¢ (mutated nucleotides...
Ngày tải lên: 29/03/2014, 00:20