... in the left pane and be sure that you are familiar with the topics presented there Become familiar with the behavior of the Web page You will need to refresh the page or use the Back button to ... seen in the examples in the second lesson and in the lab Work through each of the topic slides and discuss the central concepts and associated ideas The class may want to discuss some topics in ... Right-click the publishers table, point to Open Table, and then click Query e Click the Add table toolbar button, and then add the titles, titleauthor, and authors tables f Choose the following...
Ngày tải lên: 10/12/2013, 16:15
... (2.5 mgÆmL)1 in NaCl/Pi) was used to detach the cells from the surface and Triton X-100 (0.025% in NaCl/Pi) was then added to the cell suspension to lyse the cells The amount of adherent bacteria ... treated cells, and bacterial adhesion was significantly reduced both to epithelial cells and to skin fibroblasts treated with either of the enzymes (Fig 5C,D) The role of GAGs for adhesion was further ... the presence of IdoA residues in the GAG chain, as M protein failed to bind CS CS and DS differ mainly in the epimerization of the uronic acid (glucuronic acid in CS and IdoA in DS; Fig 1A) and...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... many areas of health care has reinforced efforts to understand mechanisms of cell injury and death during pathological conditions Idriss hypothesized [19,20] that the selective cytotoxic effect of ... tubulin and its possible link to cellular injury [11] were the first attempt to describe at the molecular level the role of free 3-nitrotyrosine as a cytotoxic agent In this case, morphological alterations ... tubulin One of them, carboxypeptidase A, catalyzes sequential release of the ultimate C-terminal amino acid (except basic residues) from peptides and proteins The other, tubulin carboxypeptidase, participates...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx
... 8.5 (the pH of the conversion step) the fatty acid is deprotonated, resulting in a negative net charge [22], potentially allowing the carboxyl-group of the fatty acid to bind to the matrix and ... reach the nuclei of intact tumor cells, and that there is clear evidence that HAMLET – not the native protein independently – is translocated to the nuclei in living tumor cells Apoptosis and macroautophagy ... in producing the cytotoxic effects Combined staining of mouse embryonic liver cells with acridine orange and ethidium bromide indicated that ELOA induces apoptotic-type cell death as previously...
Ngày tải lên: 29/03/2014, 21:20
báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf
... that the effects of CD66 mAbs were due to mAbs binding to the neutrophils and not the HUVECs [37] Furthermore, it was also possible that the Fc fragments of these mAbs could alter signaling The ... selectivity of this desensitization was observed when cells were desensitized with the CD66c mAb and the CD66de mAb, in that the cells were desensitized to CD66c and CD66de mAbs, but not to CD66ae, ... the cells to further stimulation by the CD66ae mAb and the CD66c mAb, but not by CD66b, CD66de, or CD63 mAbs (Fig 1, panel C) Finally, desensitization to the CD66ae and CD66de mAbs left the cells...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo y học: "Oral keratinocytes support non-replicative infection and transfer of harbored HIV-1 to permissive cells" ppsx
... ATGCCACGTAAGCGAAACT Linear HIV DNAa AA55M MH531 GCTAGAGATTTTCCACACTGACTAA TGTGTGCCCGTCTGTTGTGT 2-LTR circlea MH532 HIV F GAGTCCTGCGTCGAGAGAGC GTGCCCGTCTGTTGTGTGTGACT U5-U3 RNAa HIV R HIV F ACTGGTACTAGCTTGTAGCACCATCCA ... ACTGGTACTAGCTTGTAGCACCATCCA GTGCCCGTCTGTTGTGTGTGACT Gag HIV R For ACTGGTACTAGCTTGTAGCACCATCCA CCCATAGTGCAGAACATCCA Singly splicedb Rev M669 GGGCTGAAAGCCTTCTCTTC GTGTGCCCGTCTGTTGTGTGACTCTGGTA AC GCCTATTCTGCTATGTCGACACC ... trypsinization and were sensitive to cold and colchicine appeared to be harbored within TERT-2 cells and transferred to MOLT4/CCR5 cells by direct cell -to- cell interactions Discussion Lining the oral and...
Ngày tải lên: 13/08/2014, 05:21
Tin hoc 12 LT+TH 08-09
... không hợp lệ file bị xóa (violet.vn/uploads/resources/519/239521//Giaoantin12(thuchanh %20lythuyet)08-09.doc) Quay trở http://violet.vn ...
Ngày tải lên: 16/07/2013, 01:26
TH Y kien cua to chuc doan the - noi cu tru (khong co cap uy)
Ngày tải lên: 15/09/2013, 11:10
An analysic of common grammatical errors in english by 10 th graders and some pedagogical recommendations
... students The thesis is divided into chapters: Chapter I presents the rationale, aims, methods, scope and organization of the paper Chapter II presents the theoretical background of the thesis that the ... within a word Take the word “unhappy” as an example This word can be divided into “un” and “happy” They are two morphemes that contribute to the form and the meaning of the words “unhappy” The ... Although the author tries her best to work as carefully as possible to identify the correct number, it is unavoidable that the number of the errors is relative However, the researcher tried to...
Ngày tải lên: 18/12/2013, 10:04
Work Smart: Connect a Microsoft Account (Windows Live ID) to Your Domain Account pptx
... email address at the bottom of the screen to create a new email address Tap or click Next In the Help us protect your identity screen, enter the characters you see on the screen, and then tap or click ... In the first screen of the wizard, clear the check boxes for the settings that you don’t want to sync, and then tap or click Next More Work Smart Content: http://microsoft.com/itshowcase This ... mouse), tap or click the Settings charm, and then tap or click Change PC settings in the lower-right corner of the screen Under PC Settings on the left side of the screen, scroll down and tap or click...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Factor XII binding to endothelial cells depends on caveolae ppt
... with FXII, and FXII adhered to the cell surface was crosslinked to the receptor with DTSSP, as described above To avoid disruption of caveolae/lipid rafts during lyses of the cells, this and the ... binds to the cells in a manner identical to that of FXII [9] This way it was shown that progressively decreasing amounts of FXIIa adhered to the cells with increasing periods of exposure to 1% ... containing methyl-b-cyclodextrin (MbCD) and the incubation was continued for another 60 The cells were then washed, incubated with 100 nM FXII, and subsequently fixed with methanol The fixed cells were...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Binding of activated Factor XII to endothelial cells affects its inactivation by the C1-esterase inhibitor pptx
... growth medium supplemented with human recombinant endothelial cell growth factor, fibroblast growth factor and insulinlike growth factor, vascular endothelial cell growth factor, ascorbic acid, ... but also the HK/PPK complex to HUVEC Cells were incubated with the plasma for h, during which FXII was allowed to bind to the cells and to become activated Prior to the incubation, the plasma ... of using SBTI and CTI was that they were both removed from the surface of the cells during the washing procedure and thus did not interfere with the subsequent measurement of amidolytic activity...
Ngày tải lên: 23/03/2014, 20:22
gene delivery to mammalian cells, volume 1
... group to synthesize histidine-rich peptides Although they were designed to overcome difficulties encountered during the synthesis of these peptides, the methods should also be applicable to nonhistidine-containing ... incubator can be used When performing cotransfections, vary the amount of effector plasmid in relation to the other plasmids in the mix keeping the total amount of DNA the same The ratio of plasmids ... conjugated to DNA to promote entry into the cell Regardless of the type of linkage between the peptide and DNA, peptide-mediated delivery can be characterized by the pathway of entry into cells: ...
Ngày tải lên: 10/04/2014, 22:42
gene delivery to mammalian cells, volume 2
... subject them to three freeze/ thaw cycles to release the viral particles from the cells The resulting viral mini-stock represents the initial adenoviral library (see Note 4) Store the mini-stock ... Subject the plates to three freeze/thaw cycles to release the viral particles from the cells Store the plate at Ϫ20 to Ϫ80º C The amplified viral clones can be further used to infect cells for ... Add the transfection mixture to the Ad5-D[PS-E3-E4(ϩorf6)] infected cells 22 Ogorelkova et al Incubate the cells at standard conditions for 3–4 d Collect the cells together with the medium and...
Ngày tải lên: 11/04/2014, 00:48
TB-SYMKEYS 2 User library with flow diagram symbols and switch elements for GT and GN touch terminals pot
... Installation for the GT series library: The installation file for the GT support is “Setup-TB-SYMKEYS -GT- V2.1.exe“ The default installation uses the following destination folders • the colored flow ... in GTWIN Open GT libraries in GTWIN as follows: Screen shot of FPWIN Pro showing two FBs Usage in Movicon To use the TB-SYMKEYS with Movicon open the sample project and an application project Then ... all required elements from the demo application and insert it into your user application This has the advantage that the function of an element is better recognized and the work is accelerated A...
Ngày tải lên: 27/06/2014, 21:20
Đề KT HK II LT + TH
... Hay từ sân chơi Trăng bay bóng Bạn đá lên trời (theo Trần Đăng Khoa) Câu 2: Hãy lập th i khóa biểu học lớp em ? (2đ) TH I KHÓA BIỂU TH TH TH TH TH * Chú ý: ( Lưu tên tên học sinh tên lớp Ví ... Phòng GD ĐT Đam Rông Trường THCS Lê Hồng Phong Lớp: ……………………………………… Họ tên: …………………………………… ĐỀ THI HỌC KÌ II NĂM HỌC 08- 09 Môn Tin học ( th c hành) Câu 1: Hãy soạn th o văn sau? (3,5đ) TRĂNG ƠI ... bài: Câu 1: HS đánh văn không sai lỗi tả (2,5đ) Chèn hình ảnh theo mẫu (1đ) Câu 2: HS tạo bảng biểu (1đ) Viết th i khóa biểu (0.5đ) TH ...
Ngày tải lên: 04/07/2014, 05:00
GA kthk2 tin 6(lt+th) qua chi tiet
... ngang, trỏ soạn th o, vùng soạn th o, nút lệnh Lu ý: Chỉ yêu cầu trả lời th nh phần số th nh phần nêu - Định dạng văn thay đổi kiểu dáng, vị trí kí tự, đoạn văn đối tợng khác trang - Có th định dạng ... Đa trỏ soạn th o vào vị trí cần chèn - Chọn lệnh Insert Picture From File Hộp thoại Insert Picture xuất - Chọn tệp đồ họa cần thiết nháy Insert Các th nh phần có cửa sổ Word là: Thanh tiêu đề, ... - Đa trỏ soạn th o vào vị trí cần chèn - Chọn lệnh Insert Picture From File Hộp thoại Insert Picture xuất - Chọn tệp đồ họa cần thiết nháy Insert a/ Để xóa hàng bảng b/ Để chèn th m cột bên trái...
Ngày tải lên: 07/07/2014, 21:00
Báo cáo y học: "CD134 as target for specific drug delivery to T cells in adjuvant arthritis" pps
... responded to other epitopes present in the immunization mix This underlines the fact that, although CD134 may be used to select for activated pathogenic CD4+ T cells in an autoimmune setting, this molecule ... comparison with the initial elevation on day In this arthritis model, the first signs of clinical disease become manifest between days 10 and 14, and at about this time T cells start to infiltrate the ... Fig 2) When the CD4+ population was divided into CD134+ and CD134- fractions, the Mt HSP60176– + 190 response of the CD4 cells was entirely attributable to the CD134+ cells, as these cells showed...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Prior mucosal exposure to heterologous cells alters the pathogenesis of cell-associated mucosal feline immunodeficiency virus challenge" docx
... binding by either CCR5 or CXCR4 strains of HIV-1 [21] Taken together, there is strong evidence that exposure to heterologous cells and allogenic material alters the susceptibility of cells to lentiviral ... available at the time of this study, the data suggests that a reduction of the number of T-regulatory cells within the environment was associated with the development of an effector immune response ... to analyze the degree of infectivity by real-time PCR, co-culture with feline CD4+ indicator cells [27], immunocytochemistry and western blot For immunocytochemistry, cells were incubated with...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Porphyromonas gingivalis induces CCR5-dependent transfer of infectious HIV-1 from oral keratinocytes to permissive cells" doc
... Figure Total HIV-1 load associated with oral epithelial cells Total HIV-1 load associated with oral epithelial cells (A and B) TERT-2 cells were pre-incubated with and without P gingivalis and then ... cells with or without pre-incubation with P gingivalis were inoculated with R5- (Ba-L) (A and C) or X4tropic (IIIb) (B and D) HIV-1 The protocol is as described in the Materials and Methods and ... TZM-bl cells and TERT-2 cells were pre-incubated with and without P gingivalis and then inoculated with R5- or X4-HIV1 strains, washed and incubation continued in fresh medium The protocol is...
Ngày tải lên: 13/08/2014, 06:20