... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...
Ngày tải lên: 18/02/2014, 16:20
... health and physical education: 38 • Hauora (H) – a Māori philosophy of well-being that includes the dimensions, taha wairua, taha hinegaro, taha tinana, and taha whānau, each one influencing and ... develop graduate profiles for all their students through implementing their local curricula, including drug education programmes E tipu te pakiaka tangata, Me te whakatō he purapura wairua Whakahaukūtia ... categories: tobacco, alcohol, illegal drugs, and other drugs Tobacco and alcohol are self-explanatory ‘Illegal drugs’ are those that are classified as controlled drugs under the Misuse of Drugs Act 1975,...
Ngày tải lên: 22/03/2014, 15:20
Báo cáo y học: " Bilateral macular hemorrhage as a complication of drug-induced anemia: a case report" pps
... ruptured macro-aneurism of the retina and shaken baby syndrome Other rare causes include thrombocytopenia secondary to bone marrow aplasia, leukemia, autoimmune hemolytic anemia, aplastic anemia secondary ... Holland GN: Ocular toxoplasmosis: a global reassessment Part II: disease manifestations and management Am J Ophthalmol 2004, 137:1-17 Oner A, Ozkiris A, Dogan H, Erkilic K, Karakukcu M: Bilateral ... "preretinal" macular hemorrhage is actually located between the neuro fiber layer and the inner limiting membrane Causes of this hemorrhage include Valsalva maneuver, diabetic retinopathy, retinal branch...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: "HIV transmission as a result of drug market violence: a case report" pdf
... Studentship and a CIHR Doctoral Research Award Dr Kerr is supported by a MSFHR Scholar Award and a CIHR New Investigator Award References 10 11 12 13 14 Joint United Nations Programme on HIV/AIDS (UNAIDS): ... participation We also thank the administrative staff at the B.C Centre for Excellence in HIV/AIDS, as well as the VIDUS and SEOSI study staff for their research assistance Page of (page number ... study as well to the drafting and revision of the manuscript All authors have approved the final manuscript Acknowledgements The authors wish to thank the study participants for their time and participation...
Ngày tải lên: 13/08/2014, 13:21
Research on building a list of drugs, medical equipment, militant medical kits, and a mode of medical supply for policemen of K20 = Nghiên cứu xây dựng danh mục thuốc, trang thiết bị y tế, cơ số thuốc chiến đấu và phương thức đảm bảo cho K2
... their tasks and combats Methods of guaranteeing medical materials for K20 are built based on acquiring previous medical guarantee methods that are to guarantee medical materials both in cash and ... examination room, a treatment room, a laboratory, a fundamental medicine storage guaranteeing medical examination and treatment at K20 infirmary - Regarding human resources, there are 60 medical officers ... medical standards and norms, professional regulations - Didactic materials on guaranteeing ordnance task in the Military, on organizing command of military health and military medical ordnance...
Ngày tải lên: 29/09/2014, 16:23
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... ((AUC ) × Dose ) A BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis ... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... intravenously administered drug, this is known as relative bioavailability (BAR) The BAR of PA/EPI after administration was calculated using the following formula (Sonaje et al., 2009): ((AUC...
Ngày tải lên: 23/04/2013, 21:38
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 17)
... in rats J Pharm Sci 74:780–782 10) Kielbasa WB, Bauer JA, Fung HL (1999) Analysis of isobutyl nitrite inhalant in rat and human blood: application for pharmacokinetic investigations J Chromatogr ... containing different concentrations of the analyte are prepared to construct each external calibration curve, consisting of the concentration of an alkyl nitrite on the horizontal axis and peak area ... principle, the sampling, extraction and GC analysis should be made at low temperature, in a gastight state and in a short time This method is applicable to other biomedical specimens and drinks/foods...
Ngày tải lên: 18/10/2013, 00:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 67)
... GC/MS analysis for DAEMS in serum (a) a total ion chromatogram (TIC) and a mass chromatogram; (b) an EI mass spectrum of DAEMS; (c) a CI mass spectrum of DAEMS Poisoning case, and toxic and fatal ... ratio of DAEMS to IS on the vertical axis and DAEMS concentration on the horizontal axis A peak area ratio obtained from a test specimen is applied to the calibration curve to calculate a DAEMS concentration ... EMPA in serum (a) a TIC and mass chromatograms; (b) an EI mass spectrum of the t-BDMS derivative of EMPA; (c) a CI mass spectrum of the same derivative of EMPA data of animals According to the...
Ngày tải lên: 18/10/2013, 00:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 20)
... 188 Cannabinoids and their metabolites GC analysis of cannabinoids in plant specimensa Reagents and their preparation • • • Extraction and purification of cannabinoids [3]: Cannabis sativa L is ... with cannabinoid concentration on the horizontal axis and with peak area ratio of a cannabinoid to IS on the vertical axis GC analysis of cannabinoids in plant specimens ⊡ Figure 2.2 Gas chromatogram ... thin-layer and gas chromatographies Chem Pharm Bull 16:822–826 4) Yokoyama M, Okada Y, Suzuki K (1992) Determination of cannabinoids in cannabis oil by capillary gas chromatography Eisei Kagaku...
Ngày tải lên: 24/10/2013, 19:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 21)
... Morphine and its analogues 8) Matsubara K, Fukushima S, Akane A et al (1992) Increased urinary morphine, codeine and tetrahydropapaveroline in Parkinsonian patient undergoing L-3,4-dihydroxyphenylalanine ... Qualitative analysis is made by the comparison of the retention time of a peak of a specimen with that of the authentic standard and also by the confirmation of the absence of such a peak in a ... not, an appropriate amount of the above buffer solution is added to it The blank urine and calibration samples are processed in the same way These samples are equally treated according to the above...
Ngày tải lên: 24/10/2013, 19:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 70)
... cyanosis headache, dyspnea, tachypnea, tachycardia and hypertension mental derangement, listlessness and metabolic acidosis coma, convulsive attack and hypotension death A poisoning case [4] An ... layer is injected into GC Various known amounts of nitrate and a fixed amount of IS are added to blank specimens and processed in the same way to construct a calibration curve The peak area ratio ... cause of his death was diagnosed as methemoglobinemia The poison causing his methemoglobinemia was analyzed by the present method; it was disclosed that he had ingested nitrate The analytical...
Ngày tải lên: 24/10/2013, 19:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 71 and End)
... neoovoidea 480 Amanita pantherina 469 Amanita phalloides 469 Amanita verna 469, 474 Amanita virosa 469, 473 amanitin 473, 477, 479 amido-type local anesthetic 385 1-amino-4-phenylbutane 173 2-amino-6-hydroxymethyl8-hydroxyquinazoline ... 31 AED 81 A- esterase 535 air bags 629 alachlor 529 alcohol 135 alcohol dehydrogenase 123 ALD-type 137 aldehyde dehydrogenase 123, 137 aldicarb 566 aldrin 529 alkylated adducts 85 alkylated DNAs ... alkylation 30 alkyl nitrites 153, 655 allobarbital 305, 308 allylesterase 624 allyxycarb 566 alminoprofen 325, 330, 332 alprazolam 284, 285, 290 alternative specimens Amanita neoovoidea 480 Amanita...
Ngày tải lên: 24/10/2013, 19:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 22)
... phase and a cation exchanger phase; the mechanisms are reversed-phase extraction plus cation-exchanging action The LRC reservoir is advantageous, because as much as 10 mL of sample solution can ... Instruction Manual Harbor City, CA, USA 7) Abusada GM, Abukhalaf IK, Alford DD et al (1993) Solid-phase extraction and GC/MS quantitation of cocaine, ecgonine methyl ester, benzoyl-ecgonine, and cocaethylene ... pentafluoropropionic anhydride (PFPA, Tokyo Kasei Kogyo Co., Ltd., Tokyo, Japan and other manufacturers); trifluoroacetic anhydride (TFAA, manufacturers the same as above); hexafluoroisopropanol (HFIP, Kanto...
Ngày tải lên: 29/10/2013, 01:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 23)
... about A 10-mL volume of ethanol and 10 mL distilled water are passed through a Sep-Pak C18 cartridge using a 10-mL volume glass syringe to activate the cartridge at a flow rate not faster than ... chromatography Pharmazie 46:464–465 8) Seno H, Kumazawa T, Ishii A et al (2000) Determination of pentazocine in human whole blood and urine by gas chromatography/surface ionization organic mass ... grand mal She was sent to an emergency room, but still showed general cyanosis, convulsions and severe tachycardia Because of her irregular spontaneous respiration, endotracheal intubation was...
Ngày tải lên: 29/10/2013, 02:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 24)
... ingested is as small as about 10 µg and LSD is rapidly metabolized in human bodies As metabolites of LSD, 2-oxo -LSD, 3-, 13- and 14-hydroxy-LSDs and an N-de-ethyl -LSD are known [3] After oral ingestion ... ion appears as the base peak Fragment peaks can be observed at m/z 221, 207, 181 and 167 The fragmentation pathways are shown in > Fig 6.2 The confirmation of LSD should be made with each mass ... extract is evaporated to dryness; the residue is dissolved in a small amount of methanol to be subjected to further analysis TLC analysis Analytical conditions TLC plate: a usual silica gel plate,...
Ngày tải lên: 08/11/2013, 01:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 25)
... disseminated intravascular coagulation and death [19, 20] A detailed review by Kalant [16] revealed that 87 MDAs-related fatalities were associated with hyperpyrexia, rhabdomyolysis, intravascular ... altered mental status altration in muscle tone/activity automatic instability hyperthermia diarrhea hyponatremia seizures rhabdomyolysis acute renal fairure disseminated intravascular coagulation ... M et al (1991) Determination of methamphetamine and amphetamine in urine by headspace gas chromatography/mass spectrometry Anal Sci 7:19–22 25) Shima N, Kamata T, Nishikawa M et al Examination...
Ngày tải lên: 08/11/2013, 01:15
Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 26)
... fluids by headspace solid-phase microextraction (SPME) Chromatographia 43:331–333 14) Nakahara Y, Takahashi K, Sakamoto T et al (1997) Hair analysis for drugs of abuse X VII Simultaneous detection ... verbally; the levels of serum creatinin kinase and aspartate aminotransferase were more than 100-times the normal limits On hospital day 2, he became rigid, diaphoretic and had a temperature reaching ... one of many popular “club drugs” [2] GHB has a strong amnesiac action and is being implicated in a number of drug- facilitated sexual assaults [10] Since it also has growth hormone releasing effects...
Ngày tải lên: 08/11/2013, 01:15
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 27) ppt
... Mitsubishi Welpharma, Osaka, Japan; that of flupentixol by Takeda Chem Ind Ltd., Osaka, Japan; that of thioproperazine by Shionogi & Co., Ltd., Osaka, Japan; that of thiethylperazine by Sandoz, Basel, ... of a calibration curve for a target compound by LC/MS is essentially similar to that for GC/MS At least vials containing various concentrations of a target compound are prepared for a calibration ... peak area ratio of a drug to IS on the vertical axis The above peak area ratio obtained from a specimen is applied to the calibration curve to obtain its concentration 257 258 Phenothiazines Assessment...
Ngày tải lên: 15/12/2013, 12:15
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 28) pptx
... to draw a calibration curve A peak area ratio of a test specimen is applied to the calibration curve to calculate its concentration Assessment of the method The butyrophenone drugs analyzable ... Van Medical, Tokyo, p 56 (in Japanese) 19) Uges DRA (1997) Blood level data In: Brandenberger H, Maes RAA (eds) Analytical Toxicology for Clinical, Forensic and Pharmaceutical Chemists Walter de ... is used as IS for quantitation of haloperidol, and vice versa For both HPLC and LC/MS, the peak area ratio of a test compound to IS obtained from a test specimen is applied to a calibration curve...
Ngày tải lên: 15/12/2013, 12:15
Tài liệu Drugs and Poisons in Humans - A Handbook of Practical Analysis (Part 29) ppt
... antidepressants can Poisoning cases, and toxic and fatal concentrations ⊡ Table 3.2 RI values and mass spectra of tricyclic and tetracyclic antidepressants Name amitriptyline amoxapine carbamazepine ... 52:1190–1195 (in Japanese) 3) Tanaka E, Terada M, Nakamura T et al (1997) Forensic analysis of eleven cyclic antidepressants in human biological samples using a new reversed-phase chromatographic column ... of an authentic compound Although an analytical case using TSK gel Super-Octyl Poisoning cases, and toxic and fatal concentrations (particle diameter µm) was reported [3], the separation among...
Ngày tải lên: 15/12/2013, 12:15