living in ukraine as a student

Ngày tải lên: 13/03/2014, 21:56

Ngày tải lên: 21/06/2014, 02:20

Ngày tải lên: 24/06/2015, 08:16

... was within fifteen minutes. During the test, the teacher worked as a cassette player and examiner. The marking was done with the same way of assessment and then was analyzed in turn. The class ... was really an impossible subject as they always complained that “it has so many rules, it is so complicated” and that they “have no head for English”. However, as English was taught and examined ... “conceptually driven” (Brown) in that they focus on the overall meaning of a passage, and the application of schemata. Schemata are mental frameworks based on past experiences whish can be applied...

Ngày tải lên: 29/01/2014, 10:33

... branding has become a highly skilled and specialized discipline. It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, ... knew the AST brand name. The AST products have been advertised frequently in some popular newspapers and magazines, as well as participated in many trade fairs. It should be noted that though ... past 10 years, Nhat Linh company has gained a strong foothold in the market. Its market share in the Hanoi is about 90% and in Ho Chi Minh City is around 60% (Company report, 2000). It has also...

Ngày tải lên: 13/04/2013, 10:29

... phosphate buered formalin, embedded in paraf- n, sectioned, and stained with hematoxylin and eosin (H&E). In vivo pharmacokinetics and bioavailability In vivo pharmacokinetic study was conducted ... under the curve. Statistical analysis All data are presented as a mean value with its stand- ard deviation indicated (mean ± SD). Statistical analysis was conducted using the Student s t-test. ... medium, and the acute toxicity of PANs was evaluated in mice. Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug. Methods Materials Pullulan...

Ngày tải lên: 23/04/2013, 21:38

... studying the language and then output, expressed as linguistic performance when investigating language learning. In order to examine language learning in the Japanese context it is necessary ... language. At the same time it is necessary to view motivation as one of a number of variables in an intricate model of interrelated individual and situational factors which are unique to each language ... instrumental motivation has only been acknowledged as a significant factor in some research, whereas integrative motivation is continually linked to successful second language acquisition. It has...

Ngày tải lên: 06/09/2013, 10:10

Ngày tải lên: 26/11/2013, 13:31

... them attractive. They are open to all market participants, individuals included. It is a central market, just as efficient as the cash market, and whereas the cash market is a much decentralized ... the bank to deal again. In the inter-bank market, traders deal directly with dealing systems, matching systems, and brokers in a complementary fashion. All training material found in this ... exchange rates and the standard value dates. In addition, it is extremely precise and fast in contacting other parties, switching among conversations, and accessing the database. The trader...

Ngày tải lên: 10/12/2013, 10:15

... safe and productive manner. ã Online courseware and delivery offer many benefits to businesses such as: – Current and accurate training materials. – Availability of training to a wide audience. – ... resources are often called online learning experiences, or e-learning. ã Online courses can contain voice, data, and video, and are available to the students at any time from any place. Học ... adoption of the Internet has ushered in new forms of communication that empower individuals to create information that can be accessed by a global audience such as: – Instant Messaging – Weblogs...

Ngày tải lên: 12/12/2013, 14:15

Ngày tải lên: 20/12/2013, 18:26

Ngày tải lên: 21/12/2013, 13:00

... been rampant, as indicated in a report by Amnesty International (2005). In this report, researchers assert that sexual assault has included violent rape and gang rape of women of all ages, and ... associated with childbirth but instead from trauma associated with violent sexual assault. Such systematic assault against women and girls in conflict settings has led to an increased prevalence ... recto-vaginal examination and inspect the rectal area for trauma, recto-vaginal tears or fistulas, bleeding and discharge” (WHO & UNHCR, 2005). ã A statement by Thoraya Ahmed Obaid, Executive...

Ngày tải lên: 12/02/2014, 23:20

... Races. Theories of monogenism and polygenism. Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth. Eurafrica, ... of languages. Universal alphabets. Logical relations of the parts of speech. The vocabulary and the grammar of languages. Distinctions between languages and dialects. Mixed languages and jargons. ... Eurafrica, Austafrica, Asia, America, Oceanica. Causes and consequences of the migrations of races and nations. a. The Eurafrican Race.—Types of the white race. Its first home. Early migrations....

Ngày tải lên: 13/02/2014, 05:20

... the participating Table 1. Amino acid frequencies (%) in a- amylase linkers, in a set of globular proteins, in the Swiss-Prot databank and in intrinsically unstructured proteins. Amino acid Linkers a Globular proteins b Swiss-Prot c Intrinsically unstructured proteins b Ala ... Crassos- trea gigas (Mollusca, Bivalvia). Sequence data were depos- ited in GenBank (Table S1). Searches in databases Using the putative C-terminal domain of C. fluminea as a query, sequence databases ... nanomachines. Conclusions The above-mentioned amino acid bias in a- amylase linkers represents a specific and extreme trend of the bias observed in natively unfolded proteins (Table 1), as far as depletion in aliphatic ⁄ aromatic...

Ngày tải lên: 14/02/2014, 18:20

... longer a source of infection, I still keep away from others.' (Male, 21 years old, intensive phase, inpatient) Increased financial burden Most of the participants came from rural areas, and ... screened as intimate contac- tors. 'It is an infectious disease. I was worry about the trans- mission. Whether my classmates and roommates would be infected by me? Oh, I was fearful, badly fear- ful ... and the final report was translated into English. Results The 17 participants' demographic characteristics are summarized in Table 1. Three main themes were generated after analysis, as follows: Table...

Ngày tải lên: 15/02/2014, 12:20

... 12-LOX activity is induced at active sites of this disease. Because HXA 3 may play an important step underly- ing the pathophysiology of in ammatory diseases, such as in ammatory bowel disease, ... Salmonella effector protein, SipA, promotes a lipid signal transduction cascade that recruits an ADP-ribosylation factor 6 guanine nucleotide exchange factor (such as ARNO) to the apical plasma mem- brane. ... review was to highlight the recent findings that implicate hepoxilin A 3 as a key regulator of mucosal in ammation. Abbreviations AA, arachidonic acid; HpETE, hydroperoxy-eicosatetraenoic acid; HXA 3 ,8S...

Ngày tải lên: 19/02/2014, 02:20

... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â)(Nẳ A, T, G, C) and pyk- back (5Â-CTCTACATGCATTTCAACAATAGGGCCTG TC-3Â) for amplication of pyk. The resulting PCR prod- ucts, ... dened), J lactate a las ịẳ0:919 129 a las ị1 e 6a 2:1 las ị75:2 (Us er dened), J acetate a las ịẳ0:1135 30:3 a las ị1 e 6a 3:3 las ịỵ 4:66 (User dened), J formate a las ịẳ0:173 23:7 a las ị 1 ... (5Â-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3Â) and downstream to pyk using primer pyk3 (5Â-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3Â) and pyk4 (5Â-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3Â) were amplied. The PCR products...

Ngày tải lên: 19/02/2014, 17:20

... proliferation and invasion. Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48]. Thus, in most cases, choriocarcinoma ... protein expressed was predominantly localized at the plasma membrane as determined by immunoblot analysis of plasma membrane preparations. In order to test the functionality of the adenoviral SR-BI ... choriocarcinoma cell lines was isolated by using RNeasy kit (Qiagen, Vienna, Austria). Three micro- grams of total RNA were treated with RQ1 RNase-free DNase I (Promega, Mannheim, Germany) for 15 min...

Ngày tải lên: 20/02/2014, 23:20