ligand modification for solubility enhancement

... The solubility enhancements differ for the various cosolvents—in the order of increasing enhancement, ethyl acetate, acetone, methanol, ethanol, 2-propanol, and 1-propanol For example, the solubility ... similar levels of enhancement (137) On the other hand, the addition of polar cosolvents led to solubility enhancements that were solute specific, with more dramatic solubility increases for polar solutes ... resulted in a solubility enhancement of 6.2 times for 2-aminobenzoic acid, although no effect on the solubility of hexamethylbenzene was observed (138) The ability to selectively enhance the solubility...

Ngày tải lên: 02/04/2014, 15:48

... RðkÞand R2 ðkÞcontained plots that were non-forested at one or both survey times: plots not forested at time t were given an emission rate of zero for time t For ðk;tÞ this reason, the grid-cell averages ... aerosol particle formation and growth in boreal forest Geophysical Research Letters, 24, 1219–1222 Martin GL (1982) A method for estimating ingrowth on permanent horizontal sample points Forest Science, ... American forest plantations: opportunities for carbon sequestration, economic development and financial returns Journal of Forestry, 98, 20– 23 Zhou XP, Mills JR, Teeter L (2003) Modelling forest...

Ngày tải lên: 14/02/2014, 08:20

... boundary May,1999 March, 2004 Dense forest Open forest Shifting cultivation Bamboo Field crop Wet paddy Irrigated paddy field Reservoir Shrub land/other Dense forest Open forest Shifting cultivation ... (decreased/increased) and fragmented (field crop, evergreen forest, fallow forest) as a result of both farmers who lost their lands and turned to clear-cut forest areas for upland rice cultivation, and private ... soil Shrub/other crops Total Changes land use classes Changed Dark evergreen forest Bright evergreen forest Disturbed forest/fallow Bamboo Field crop Wet paddy Irrigation paddy Bare land/Wet soil...

Ngày tải lên: 17/03/2014, 11:20

... stages,  5% O2 for 1, and h (B) Third instar larvae,  5% O2 for 24 h (C) Third instar larvae, 1% O2 for 1, and h (D) Third instar larvae,  5% O2 for 20 alternating with 21% O2 for 20 min, repeated ...  5% O2 for 24 h (B) Third instar larvae, 1% O2 for 1, and h (C) Third instar larvae,  5% O2 for 20 alternating with 21% O2 for 20 min, repeated three times (D) Adult flies,  5% O2 for and h ... repeated three times (E) Third instar larvae, 95% O2 for 12 h (F) adult flies,  5% O2 for and h (G) Adult flies  5% O2 for 24 h and 12% O2 for 24 h *P < 0.05 5110 FEBS Journal 275 (2008) 5108–5116...

Ngày tải lên: 30/03/2014, 02:20

... conditions were as follows: 50°C for -Activation, 95°C for 10 - Initial Denaturation, 95°C for 15 s - Denaturation 40 cycles, 50°C for 30 s - Annealing, 60°C for - Final Extension The ΔΔCT method ... Research (CSIR) for Senior Research Fellowship Peeyush Kumar T thanks DST for SRF Jobin Mathew thanks CSIR for SRF Author Details Molecular Neurobiology and Cell Biology Unit, Centre for Neuroscience, ... concentrations (200- 250 μg) Nonspecific binding for muscarinic M3 receptor was determined using 100 μM of 4-DAMP mustard Tubes were incubated at 22°C for 60 minutes and filtered rapidly through GF/C...

Ngày tải lên: 10/08/2014, 05:21

... of (page number not for citation purposes) AIDS Research and Therapy 2009, 6:26 PCR system Micro Fluidic Cards were analysed with RQ documents and the RQ Manager Software for automated data analysis ... that were undergoing fenofibrate treatment (Spearman, ρ = 0.7; p = 0.02) The expression of ligands for these receptors was clearly different We did not find any significant effect of fenofibrate ... increasing SDF-1 values SDF-1 plays a significant role in HIV infection because it is the natural ligand for CXCR4 which is used by HIV Ttropic strains to enter into the cells in advanced stages of...

Ngày tải lên: 10/08/2014, 05:21

... cycles of 95°C for 15 s and 58°C A dissociation protocol was performed in all cases Quantification for each primer pair and cDNA template combination was performed in triplicate for each of the ... RTPCR was performed using SYBR Greener qPCR Supermix for ABI Prism (Invitrogen) The primers used are available in Additional file Reaction conditions were as follows: 50°C for mins; 95°C for 10 mins; ... manuscript CL grew the plants, collected all tissues for analysis He performed all RNA extractions and prepared samples for array analysis JAC performed quality control of RNA and carried out the...

Ngày tải lên: 12/08/2014, 03:20

... performed and bronchoalveolar lavage fluid was obtained for assessment of inflammatory cell counts, total protein, nitrate/nitrite (nitric oxide) and glutathione levels The lungs were removed for ... was centrifuged at 1500 rpm for minutes at 4°C and the supernatant was retained for measurements of nitric oxide, glutathione levels and protein levels using a Bradford Assay The separate mL aliquots ... 10% buffered formalin, fixed overnight with formalin Tissues were embedded in paraffin blocks, cut into μm sections and stained with hematoxylin and eosin Sections were evaluated for epithelial...

Ngày tải lên: 12/08/2014, 11:22

... http://arthritis-research.com/content/12/4/131 has also been shown to influence human cartilage properties [8,9] For example, shortly after exercise, an elevation of serum levels of cartilage oligomeric matrix ... increase in IL-10 and decrease in COMP be confirmed in comparable studies? What is the evidence for a causal relationship of IL-10 and COMP, or are the changes coincidences? Why is COMP, but none ... M, Malaise M, Emery P, Dougados M: Clinical and ultrasonographic predictors of joint replacement for knee osteoarthritis: results from a large, 3-year, prospective EULAR study Ann Rheum Dis 2010,...

Ngày tải lên: 12/08/2014, 14:22

... changes in arterial pressure for predicting volume responsiveness There are so many factors that can affect the phenomena that the technique’s use should be reserved for very limited controlled ... increases in the stroke volumes Two other factors also might be involved First, dUp probably accounted for a significant part of the PPV dUp is related to the decrease in afterload with a positive pressure ... Magder Critical Care 2010, 14:197 http://ccforum.com/content/14/5/197 There are other mechanisms that can produce PPV with positive pressure...

Ngày tải lên: 13/08/2014, 21:21

... autoinduction media (25 mM for Na2HPO4 and KH2PO4, 50 mM for NH4Cl, mM for Na2SO4, 0.015% (w/v) for D-glucose, 0.6% (w/v) for alpha-lactose, 1.2% (w/v) for glycerol, and mM for MgSO4, prepared in-house) ... First forward primer for sequencing gelsolin and variants 5' agggaccatgtccgtctc Second forward primer for sequencing gelsolin and variants 5' ctgttgaggtattgcctaaggc First reverse primer for sequencing ... 5'-ggatgacgtaggcgttgcccgtgaagaagtc Forward primer for Glu97Gln mutation in gelsolin domain 5'-tgagtgcagccaggatcagagcgggg Reverse primer for Glu97Gln mutation in gelsolin domain 5'-ccccgctctgatcctggctgcactca Forward primer for...

Ngày tải lên: 11/09/2015, 10:17

... abbreviations XI NCBI National center for biotechnological information nt Nucleotides OCS Oestrus cow serum OPU Ovum pick up P4 Progesterone PCR Polymerase chain reaction PFA Paraformaldehyde PGF2α Prostaglandin ... mature-to-precursor forms can additionally illustrate this particular expression pattern at the MET, especially with miR-130a where the mature form decreased to an equal concentration to the precursor form ... decrease of the mature form at the blastocyst stage suggests a role for the miRNA during the MET With these differential values obtained between the mature and the precursor forms, a recent study...

Ngày tải lên: 25/11/2015, 14:53

Ngày tải lên: 26/11/2015, 12:46

... were eliminated after centrifugation at 5000 g, for 10 High speed centrifugation (100 000 g for 30 at °C) was performed to clear the supernatant, before glutathione–Sepharose affinity chromatography ... changes in the phospholipid packing of the lipid bilayer and has been suggested as critical for microdomain formation [21] Finally, Keller et al [22] reported that changing the nature of the sterol ... A (CSA) effectively inhibits mPTP opening under almost all conditions, and is therefore considered a marker for mPT To determine whether the altered mitochondrial permeability observed in the...

Ngày tải lên: 07/03/2014, 05:20

... infection [3] It is currently the leading indication for a liver transplant and is responsible for 8,000–10,000 deaths annually Interferon (IFN) has formed the backbone of therapy against HCV, first ... administered subcutaneously once a week for 10 weeks (days 1, 7, 14, 21, 28 ), plus ribavirin (13 ± mg/kg/day) Patients had blood drawn for Page of 15 (page number not for citation purposes) Journal of ... with 1-Bromo-3-chloropropane (BCP)-phase separation agent for minute, and incubated at room temperature for 15 minutes After centrifugation for 15 minutes at 12,000 rpm and 4°C, RNA was precipitated...

Ngày tải lên: 18/06/2014, 15:20

... Cells were incubated for h with AlPcS2 in HBSS, irradiated with red light at a light dose of 450 J/cm2 and incubated for different time periods in growth medium before staining formed and additional ... not stated otherwise due to Bonferroni correction for multiple comparisons SAS v9.2 for windows (SAS Institute Inc., Cary, NC, USA) was used for statistical analysis of the data Gupta et al ... correction for pairwise group comparisons For all the analysis, type-I error rate was set to 5% but multiple comparison was handled by using Bonferroni correction in which type-I error rate for pairwise...

Ngày tải lên: 18/06/2014, 16:20

... positive for PAS staining Discussion Cellular alterations were found in all cytological specimens Based on the clinical and cytological findings, further serologic studies were performed to search for ... be pathologically significant for EBV infection Findings of this type call for close monitoring of the patient and follow-up cytological studies that will check for the persistence of viral infection ... inflammatory infiltration of the lymphoplasma cells and eosinophilia" The ultrastructure study for the search for virus or viral particles conducted by the Electron Microscopy Center of the National...

Ngày tải lên: 19/06/2014, 08:20

... positive for PAS staining Discussion Cellular alterations were found in all cytological specimens Based on the clinical and cytological findings, further serologic studies were performed to search for ... be pathologically significant for EBV infection Findings of this type call for close monitoring of the patient and follow-up cytological studies that will check for the persistence of viral infection ... inflammatory infiltration of the lymphoplasma cells and eosinophilia" The ultrastructure study for the search for virus or viral particles conducted by the Electron Microscopy Center of the National...

Ngày tải lên: 20/06/2014, 04:20

... still remaining after years for pine Besides Vance and Chapin (2001) recorded that in boreal forests where cold climatic conditions prevail spruce forests have indigestible forest floor within high ... characterized by the absence of N for biological demands Garten (2006) recorded that the total nitrogen content of forest floor demonstrated the ranges between 0.58–0.66% J FOR SCI., 54, 2008 (7): 306–313 ... Pinus roxburghii forests in central Himalaya Forest Ecology and Management, 131: 191–199 VANCE E.D., CHAPIN III F.S., 2001 Substrate limitations to microbial activity in taiga forest floors Soil...

Ngày tải lên: 07/08/2014, 03:22

... resuspended in 0.1M Tris-HCl buffer J FOR SCI., 57, 2011 (1): 1–7 (pH 7.2) containing 0.1M KCl and stirred for h at 20°C The extract was centrifuged (3,000 g for 10 min) and the protein content ... methanol in mortar, stirred on an orbital shaker for 60 at room temperature and then centrifuged (5,000 × g for 20 min) The supernatant was evaporated in J FOR SCI., 57, 2011 (1): 1–7 RESULTS 200 p-HBA ... cultures were used for the experiments Pathogen culture Stock culture of the non-lyophilized mycelium of Sirococcus strobilinus was obtained from Dr A Lilja (METLA, Finnish Forest Research Institute,...

Ngày tải lên: 07/08/2014, 10:21