... Story of the Days of Nelson By England's Aid: The Freeing of the Netherlands By Pike and Dyke: A Tale of the Rise of the Dutch Republic Facing Death: A Tale of the Coal-mines In the Heart of the ... with all relating to the habits, and, so far as is known, of the language of the ancient Britons, Saxons, Danes, and the natives of the northern part of the island, will be of inestimable advantage ... the brave tribes of New Zealand and the forces of England and the colony That struggle lasted over a period of some years, and to justice to its numerous incidents in the course of a single volume...
Ngày tải lên: 15/03/2014, 12:20
... state The paper compares three cases of governance of the biotechnology sector: Finland and Sweden, the USA and the UK, and Australia The aim is to integrate research on innovation systems (the ... Gertler 2004) Another Lofgren & Benner The Political Economy of the New Biology’ – preliminary draft only core theme in the understanding of the role of the state in the knowledge-based economy ... by the Nordic countries, in particular Finland and to some extent Sweden; the second by the US and the UK, and the third by Australia Biotechnology governance in Sweden and Finland The Scandinavian...
Ngày tải lên: 13/03/2014, 21:59
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot
... 69.0, 63.4, and 52.6 were higher than the others and were subsequently assigned to the NeuAc residue Analysis of both of the 1H- and the 13C-NMR spectra using 1D and 2D techniques gave the data ... polysaccharide and the fraction was not further investigated The proportion of the minor polysaccharide was indicated by the size of the minor peaks in the H-NMR spectrum (Fig 2), especially as the peak ... spectrum of the Hafnia alvei lipopolysaccharide showing the anomeric and the ring proton/carbon region and including high resolution 1H- and 13C-NMR spectra MALDI-MS of the O-polysaccharide The O-polysaccharide,...
Ngày tải lên: 24/03/2014, 04:21
báo cáo khoa học:" Performance and cross-cultural comparison of the short-form version of the CPQ11-14 in New Zealand, Brunei and Brazil" pps
... that the generalisability of the findings is limited On the other hand, the relative uniformity of findings in convenience samples from a number of different communities within New Zealand and ... utility of the CPQ11-14 and the underlying importance of the measure Author details Department of Oral Rehabilitation, School of Dentistry, University of Otago, New Zealand 2Department of Oral ... having the short-form self-administered) in the two New Zealand samples, and it is more than likely the difference in scores may reflect differences in the populations of adolescents in the New Zealand...
Ngày tải lên: 12/08/2014, 01:22
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan
... region and periphery of the Seto Inland Sea The location of the research area and the distribution of the citrus groves in Matsuyama region are shown in Fig Matsuyama is situated in Shikoku Island ... fruits is popular The ratio of the citrus groves to the total land use is more than 10% in Ehime alone Furthermore, it is reported that the pH of the grove soils is less than 4, and the soil contains ... kind of citrus called Iyokan is mainly cultivated There are two small streams on the upper part of the hill and the streams flow together from 47 m above sea level The water in the stream is the...
Ngày tải lên: 05/09/2013, 10:17
Getting to Know the Writing Section of the New SAT
... others that could be easier for you If you have extra time, you can go back to the tough ones and try again Determining the Level of Difficulty How the writers of the SAT determine the level of ... versions of a sentence—you choose the one that is most clear and correct Improving Paragraphs Only about 10% of the questions in the writing section are this type, which is good news They are the ... instead of two; the top score is 2,400 rather than 1,600 The test is now three hours and 45 minutes long The Writing section is new; it’s comprised of the essay (25 minutes) and two multiple-choice...
Ngày tải lên: 02/11/2013, 18:20
Tài liệu Project Management 2.0 – The Ultimate Benefits of the New Approach to Project Management docx
... things On one hand, these factors lead to obsolete and useless project plans On the other hand, they increase the cost of errors in the initial design of the information hierarchy The whole process ... productivity and therefore curtailing the efficiency of the rest of the project team The new wave of project management tools puts an emphasis on collaboration and makes teams much more productive These ... to the right information at the right time through a system of interconnected applications and services Examples of thousands of small companies and giants like Microsoft, Toyota and many others...
Ngày tải lên: 18/02/2014, 07:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... Given that the roles of these residues definitely confirm each other, the difference in their significance might be attributable to the importance and ⁄ or necessity of the receipt of the phenol-hydroxyl ... environments of BPA in the ligand-binding pocket of the ERRc The proximity of each amino acid residue (within a ˚ distance of A) to BPA is shown in the boxes depicting the a-helices The portrait ... activity of BPA (1 and 10 lM) against the inverse agonist activity of 4-OHT (1 and 10 lM) The assay set marked with an asterisk shows the the inverse antagonist activity of BPA for lM 4-OHT, and the...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: The structure and biological characteristics of the Spirochaeta aurantia outer membrane glycolipid LGLB pdf
... Fragments of HSQC and HMBC spectra of compound Labels illustrate assignment of the amide linkage between the amino group of Asp and the carboxyl group of GalA residue E Scheme The structures of oligosaccharides ... monosaccharides present in the products and were identified, and the ratio of structures and was close to : All chemical shifts remained mostly unchanged with the exception of H/C-2 and H/C-3 of the glycerol ... because of the existence of branches in the molecule Similarly, the tandem MS was conducted for the doubly charged ion at m/z 1180.25 (data not shown) and the mass spectral data fully agree with the...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo " Characteristics of the voi mep massif’s altitudinal belt differentiation " doc
... elevations of less than 750m on the eastern slope and less than 800m on the western slope Generally, the area topography has large slopes and is strongly dissected The results of soil profile analyses ... surfaces The combination and interaction of natural components led to the formation of two altitudinal landscape belts: mountain foot tropical landscape belt and medium montane subtropical belt Their ... Characteristics of the Voi Mep massif’s altitudinal belt differentiation 11 Topographic features of the Voi Mep massif Voi Mep massif with the highest peak (1739m) of the same name...
Ngày tải lên: 05/03/2014, 16:20
Whatever Happened to Frank and Fearless- The Impact of the New Public Management on the Australian Public Service ppt
... of the debate In 2006 the then Secretary of the Department of the Prime Minister and Cabinet, Dr Peter Shergold, described the ‘Children Overboard’ affair and the mistreatment of Cornelia Rau and ... provide the same high standard of policy advice, implementation and professional support, irrespective of which political party is in power This is at the core of the professionalism of the APS The ... Nevertheless, the APS Values are the artefact of legislation, and reflect the views of the executive and the Parliament at a particular point in time about the conduct of public administration Their...
Ngày tải lên: 06/03/2014, 13:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... together, these data confirm the specificity of the SenR-binding sites and corroborate the assumption that phosphorylation of SenR by SenSP alters its DNA-binding characteristics Discussion The ... of pWKB1 The plasmid pUR1 was then used for PCRs and further ligation The desired PCR products were obtained using the forward primer R1NSph (5¢-CAGCGC ATGCTGCTCCAGGCAGCCGAC-3¢), and one of the ... (located upstream of hbpS and ending at the 5¢-end of binding site III) GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III) For sequence and characteristics, ...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo "Preparation and characteristics of the In-doped ZnO thin films and the n-ZnO:In/p-Si heterojunctions for optoelectronic switch" potx
Ngày tải lên: 14/03/2014, 13:20
The Cleveland Eraby A Chronicle Of The New Order In Politics (dodo Press) By Henry Jones Ford pdf
... Britain the entire question of the fishery rights of the two governments and 38 The Cleveland Era: A Chronicle of the New Order in Politics their respective citizens on the coasts of the United ... which became for them the tomb of the Capulets; most of them were never heard of afterward From the Senate there were 2700 bills Nine tenths of the time of the committees of the Forty-eighth ... duties of office The Constitution provides that “in case of the removal of the President from office, or of his death, resignation, or inability to discharge the powers and duties of the said office,...
Ngày tải lên: 16/03/2014, 09:20
Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc
... making the management of the disease easier Median value of PCI of family of the patients was Rs 400 and mean value was Rs 543 with a range of Rs 100 - 2500 The mean PCI of family of the patients ... neoplasia Among the patients with history of multiple sexual partners of their husbands, 94.4% patients and among the patients with history of STD syndrome of their husbands, all the patients were ... cases occurred between the ages of 35 and 49 years The mean age of cervical cancer cases was 45.7 years and 38.3% of ovarian cancer cases occurred between the ages of 35 and 49 years A study done...
Ngày tải lên: 22/03/2014, 11:20
ANNALS OF THE NEW YORK ACADEMY OF SCIENCES - Full cost accounting for the life cycle of coal potx
... estimates of the social cost of carbon the valuation of the damages due to emissions of one metric ton of carbon, of $30/ton of CO2 equivalent (CO2 e),20 with low and high estimates of $10/ton and ... measure of the costs of climate change is the rising costs of extreme weather events, though these are also a function of and real estate and insurance values Overall, the costs of weather-related ... in the U.S Northeast was linked to approximately 70 deaths, tens of thousands of asthma attacks, and hundreds of thousands of episodes of upper respiratory illnesses annually.89 A reanalysis of...
Ngày tải lên: 23/03/2014, 00:20
Quantitative Analysis in Financial Markets Collected papers of the New York University Mathematical Finance Seminar, Volume II docx
... graduate of France's Ecole Polytechnique Marco Avellaneda is Professor of Mathematics and Director of the Division of Financial Mathematics at the Courant Institute of Mathematical Sciences of New ... deviations around the mean of the density, and is also compared to the uniform error for the Euler approximation The striking feature of the results is the speed of convergence to zero of the approximation ... Euler approximation and the exact density on the one hand, and between the first three terms in the expansion and the exact density on the other As can be seen from these figures, the expansion in...
Ngày tải lên: 23/03/2014, 12:20
The Hispanic Nations of the New World pdf
... in the Mexican part of the viceroyalty of New Spain the cry of independence raised by Morelos and his bands of Indian followers had been stifled by the capture and execution of the leader But the ... all the colonial domains was the government of their majesties, the monarchs of Spain and Portugal A ministry and a council managed the affairs of the inhabitants of America and guarded their ... other Independence was to be the fortune of the Spanish Americans, and a continuance of despotism, for a while, the lot of the Spaniards As the region of the viceroyalty of La Plata had been the...
Ngày tải lên: 24/03/2014, 03:21
the new terrorism fanaticism and the arms of mass destruction
... join the Weathermen The students knew nothing about the problems of the ghetto and about unemployment They were motivated by a crisis of identity, suburban bore29 | |The New Terrorism dom, and the ... Another early example of terrorists is the Order of the Assassins in the eleventh century, an offshoot of the Ismailis, a Muslim sect Hassan I Sabah, the founder of the order, was born in Qom, the ... imperfect The campaign of the Tupamaros caused the rise of a military dictatorship and destroyed the democratic system, and, at the same time, brought about the destruction of their own movement By the...
Ngày tải lên: 03/06/2014, 01:12
oklahoma residential real estate brokerage an investigation of the impact of the new broker relationship act
... changes in the marketplace have clouded the role of brokers, blurring the lines of responsibility The origination of these changes vary; some of the changes stem from new public policies and others ... brought with them the laws of their native land including the laws concerning land ownership Except for Louisiana, Texas, and portions of the Southwest, where the civil laws of France and Spain ... report The first chapter contains an introduction to the study comprising of an introduction to the problem, statement of the problem, a background of the problem, purpose of the study, nature of the...
Ngày tải lên: 03/06/2014, 02:08